Incidental Mutation 'R6375:Il1r1'
ID514896
Institutional Source Beutler Lab
Gene Symbol Il1r1
Ensembl Gene ENSMUSG00000026072
Gene Nameinterleukin 1 receptor, type I
SynonymsIL-1R1, IL-iR, CD121a, IL-1 receptor alpha chain, Il1r-1
MMRRC Submission
Accession Numbers

Genbank: NM_008362, NM_001123382

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6375 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40225080-40317257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40294890 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 207 (Y207N)
Ref Sequence ENSEMBL: ENSMUSP00000110443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027241] [ENSMUST00000114795]
Predicted Effect probably damaging
Transcript: ENSMUST00000027241
AA Change: Y210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027241
Gene: ENSMUSG00000026072
AA Change: Y210N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 38 117 2.94e-1 SMART
IG_like 132 218 5.56e0 SMART
IG 236 333 1.35e0 SMART
Blast:TIR 347 381 1e-7 BLAST
TIR 387 544 1.93e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114795
AA Change: Y207N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110443
Gene: ENSMUSG00000026072
AA Change: Y207N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 35 114 2.94e-1 SMART
IG_like 129 215 5.56e0 SMART
IG 233 330 1.35e0 SMART
Blast:TIR 344 378 1e-7 BLAST
TIR 384 541 1.93e-29 SMART
Meta Mutation Damage Score 0.4402 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that belongs to the interleukin-1 receptor family. The encoded protein is a receptor for interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist. It is an important mediator involved in many cytokine-induced immune and inflammatory responses. This gene is located in a cluster of related cytokine receptor genes on chromosome 2q12. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, reduced IL1b responsiveness, delayed tooth eruption, decreased susceptibility to experimental autoimmune uveoritinitis, decreased susceptibility to kidney reperfusion injury, and late onset obesity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,562 I797N possibly damaging Het
Actbl2 A G 13: 111,255,944 E271G probably damaging Het
Aplp2 T C 9: 31,157,788 N526D probably benign Het
Cacna1e A C 1: 154,479,305 N389K probably damaging Het
Ccdc18 T C 5: 108,174,954 I640T possibly damaging Het
Ccdc39 T A 3: 33,814,367 T857S probably benign Het
Ccser1 T A 6: 61,311,168 L105* probably null Het
Efhc1 T A 1: 20,972,940 M361K probably benign Het
Eml5 T C 12: 98,798,868 Het
Fgfr2 C A 7: 130,167,745 L637F probably damaging Het
Fmo9 A G 1: 166,664,595 probably null Het
Gm4302 A G 10: 100,341,396 T181A probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hoxb4 A G 11: 96,320,327 *251W probably null Het
Kcnc2 C T 10: 112,463,189 T622M possibly damaging Het
Kcnk9 C T 15: 72,546,243 A13T probably benign Het
Kdm4c C T 4: 74,330,715 P69S probably damaging Het
Kmt2e T C 5: 23,499,519 S1237P probably benign Het
Lrrc37a G A 11: 103,501,089 T1170I probably benign Het
Lyn T A 4: 3,745,527 F109I probably damaging Het
Lynx1 T C 15: 74,751,319 Y88C probably damaging Het
Mon1b T A 8: 113,638,077 I162N probably damaging Het
Muc4 A G 16: 32,736,243 probably benign Het
Nbn T A 4: 15,979,327 F437L probably benign Het
Neil3 T C 8: 53,587,276 K564E possibly damaging Het
Nfe2l1 A T 11: 96,820,051 S293T probably damaging Het
Olfr121 T A 17: 37,752,099 S82T probably benign Het
Olfr292 C T 7: 86,695,059 A201V probably benign Het
Olfr577 T C 7: 102,973,753 T80A probably damaging Het
Olfr706 C A 7: 106,886,014 A268S probably benign Het
Pcdhb22 A T 18: 37,518,304 probably benign Het
Pcdhgb6 A G 18: 37,742,625 N129D probably damaging Het
Pias2 C T 18: 77,152,670 T574M possibly damaging Het
Plec G A 15: 76,177,640 T2564I probably damaging Het
Qrich2 A G 11: 116,458,228 probably benign Het
Scgb1b12 T A 7: 32,334,459 V48E probably damaging Het
Scn5a A T 9: 119,543,356 L224Q probably damaging Het
Snx3 T A 10: 42,534,731 Y132* probably null Het
Stk39 T A 2: 68,392,238 I161F probably benign Het
Tcaf2 A C 6: 42,626,178 L816R probably damaging Het
Thap4 C A 1: 93,725,156 probably null Het
Tmc5 T A 7: 118,656,814 V704E probably damaging Het
Tmem39a A G 16: 38,585,237 T59A probably benign Het
Tshz2 A G 2: 169,886,019 N376S probably damaging Het
Vmn1r60 T C 7: 5,545,018 N28D probably damaging Het
Zfp637 C T 6: 117,845,324 R138W probably damaging Het
Other mutations in Il1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Il1r1 APN 1 40313170 missense probably damaging 1.00
IGL01532:Il1r1 APN 1 40294928 critical splice donor site probably null
IGL01610:Il1r1 APN 1 40302400 missense probably benign 0.09
IGL01668:Il1r1 APN 1 40313329 missense probably benign 0.31
IGL01729:Il1r1 APN 1 40294826 missense probably damaging 1.00
IGL02201:Il1r1 APN 1 40313268 missense probably damaging 0.97
IGL02229:Il1r1 APN 1 40313358 missense probably damaging 0.99
IGL02428:Il1r1 APN 1 40313232 missense possibly damaging 0.74
IGL02902:Il1r1 APN 1 40302409 missense probably benign 0.09
G5030:Il1r1 UTSW 1 40313163 missense possibly damaging 0.80
R0604:Il1r1 UTSW 1 40282246 missense probably benign 0.36
R1515:Il1r1 UTSW 1 40293349 nonsense probably null
R1530:Il1r1 UTSW 1 40312361 missense probably benign 0.00
R1727:Il1r1 UTSW 1 40293264 missense probably benign 0.16
R1957:Il1r1 UTSW 1 40313140 nonsense probably null
R2163:Il1r1 UTSW 1 40294863 missense probably benign 0.00
R2313:Il1r1 UTSW 1 40313310 missense probably benign 0.19
R4345:Il1r1 UTSW 1 40297924 missense probably benign 0.00
R4622:Il1r1 UTSW 1 40312420 missense probably damaging 0.96
R4735:Il1r1 UTSW 1 40293295 missense probably benign 0.00
R5033:Il1r1 UTSW 1 40293524 missense probably damaging 1.00
R5586:Il1r1 UTSW 1 40225251 start gained probably benign
R6383:Il1r1 UTSW 1 40313335 missense possibly damaging 0.58
R6618:Il1r1 UTSW 1 40300811 missense probably damaging 0.97
R7169:Il1r1 UTSW 1 40293359 critical splice donor site probably null
R7384:Il1r1 UTSW 1 40282261 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTAAACCATTCCACTGCACAGG -3'
(R):5'- TCCAGTGTGCCCATGAAATCC -3'

Sequencing Primer
(F):5'- ACAGGGGAGCTCCTAACTGTC -3'
(R):5'- GCATTCTCTCTGGACACATGAG -3'
Posted On2018-05-04