Incidental Mutation 'R6375:Gpat2'
ID514901
Institutional Source Beutler Lab
Gene Symbol Gpat2
Ensembl Gene ENSMUSG00000046338
Gene Nameglycerol-3-phosphate acyltransferase 2, mitochondrial
SynonymsGpat2, A530057A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6375 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127425199-127436092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 127431918 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 294 (G294R)
Ref Sequence ENSEMBL: ENSMUSP00000049619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]
Predicted Effect probably benign
Transcript: ENSMUST00000028848
SMART Domains Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

DomainStartEndE-ValueType
low complexity region 47 53 N/A INTRINSIC
Pfam:FAA_hydrolase 107 313 3.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062211
AA Change: G294R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: G294R

DomainStartEndE-ValueType
PlsC 199 333 1.45e-11 SMART
Blast:PlsC 347 387 7e-13 BLAST
low complexity region 431 468 N/A INTRINSIC
low complexity region 515 528 N/A INTRINSIC
low complexity region 593 613 N/A INTRINSIC
low complexity region 664 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146757
Meta Mutation Damage Score 0.3984 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,562 I797N possibly damaging Het
Actbl2 A G 13: 111,255,944 E271G probably damaging Het
Aplp2 T C 9: 31,157,788 N526D probably benign Het
Cacna1e A C 1: 154,479,305 N389K probably damaging Het
Ccdc18 T C 5: 108,174,954 I640T possibly damaging Het
Ccdc39 T A 3: 33,814,367 T857S probably benign Het
Ccser1 T A 6: 61,311,168 L105* probably null Het
Efhc1 T A 1: 20,972,940 M361K probably benign Het
Eml5 T C 12: 98,798,868 Het
Fgfr2 C A 7: 130,167,745 L637F probably damaging Het
Fmo9 A G 1: 166,664,595 probably null Het
Gm4302 A G 10: 100,341,396 T181A probably benign Het
Hoxb4 A G 11: 96,320,327 *251W probably null Het
Il1r1 T A 1: 40,294,890 Y207N probably damaging Het
Kcnc2 C T 10: 112,463,189 T622M possibly damaging Het
Kcnk9 C T 15: 72,546,243 A13T probably benign Het
Kdm4c C T 4: 74,330,715 P69S probably damaging Het
Kmt2e T C 5: 23,499,519 S1237P probably benign Het
Lrrc37a G A 11: 103,501,089 T1170I probably benign Het
Lyn T A 4: 3,745,527 F109I probably damaging Het
Lynx1 T C 15: 74,751,319 Y88C probably damaging Het
Mon1b T A 8: 113,638,077 I162N probably damaging Het
Muc4 A G 16: 32,736,243 probably benign Het
Nbn T A 4: 15,979,327 F437L probably benign Het
Neil3 T C 8: 53,587,276 K564E possibly damaging Het
Nfe2l1 A T 11: 96,820,051 S293T probably damaging Het
Olfr121 T A 17: 37,752,099 S82T probably benign Het
Olfr292 C T 7: 86,695,059 A201V probably benign Het
Olfr577 T C 7: 102,973,753 T80A probably damaging Het
Olfr706 C A 7: 106,886,014 A268S probably benign Het
Pcdhb22 A T 18: 37,518,304 probably benign Het
Pcdhgb6 A G 18: 37,742,625 N129D probably damaging Het
Pias2 C T 18: 77,152,670 T574M possibly damaging Het
Plec G A 15: 76,177,640 T2564I probably damaging Het
Qrich2 A G 11: 116,458,228 probably benign Het
Scgb1b12 T A 7: 32,334,459 V48E probably damaging Het
Scn5a A T 9: 119,543,356 L224Q probably damaging Het
Snx3 T A 10: 42,534,731 Y132* probably null Het
Stk39 T A 2: 68,392,238 I161F probably benign Het
Tcaf2 A C 6: 42,626,178 L816R probably damaging Het
Thap4 C A 1: 93,725,156 probably null Het
Tmc5 T A 7: 118,656,814 V704E probably damaging Het
Tmem39a A G 16: 38,585,237 T59A probably benign Het
Tshz2 A G 2: 169,886,019 N376S probably damaging Het
Vmn1r60 T C 7: 5,545,018 N28D probably damaging Het
Zfp637 C T 6: 117,845,324 R138W probably damaging Het
Other mutations in Gpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Gpat2 APN 2 127432396 missense probably benign 0.01
IGL00479:Gpat2 APN 2 127434461 missense probably damaging 0.99
IGL01393:Gpat2 APN 2 127432651 missense probably damaging 1.00
IGL01759:Gpat2 APN 2 127430896 missense possibly damaging 0.94
IGL01764:Gpat2 APN 2 127427536 missense probably benign 0.18
IGL02631:Gpat2 APN 2 127434232 splice site probably benign
IGL02657:Gpat2 APN 2 127427331 missense probably benign 0.04
IGL02813:Gpat2 APN 2 127434455 missense possibly damaging 0.90
IGL02873:Gpat2 APN 2 127431755 missense probably benign 0.00
IGL02993:Gpat2 APN 2 127427566 missense probably damaging 1.00
R6669_gpat2_048 UTSW 2 127431918 missense possibly damaging 0.90
PIT4494001:Gpat2 UTSW 2 127433880 missense probably benign 0.00
R0078:Gpat2 UTSW 2 127428249 missense probably damaging 1.00
R0230:Gpat2 UTSW 2 127435845 missense possibly damaging 0.95
R1619:Gpat2 UTSW 2 127428717 missense probably benign 0.00
R1851:Gpat2 UTSW 2 127434819 missense possibly damaging 0.77
R1939:Gpat2 UTSW 2 127435959 makesense probably null
R2143:Gpat2 UTSW 2 127433762 missense probably damaging 1.00
R2165:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R2518:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3410:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3411:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3898:Gpat2 UTSW 2 127435098 missense probably damaging 1.00
R4080:Gpat2 UTSW 2 127433622 missense probably damaging 0.99
R4725:Gpat2 UTSW 2 127431982 missense possibly damaging 0.83
R4841:Gpat2 UTSW 2 127433967 missense probably benign 0.10
R5354:Gpat2 UTSW 2 127428723 missense probably damaging 1.00
R5941:Gpat2 UTSW 2 127428275 missense possibly damaging 0.53
R6362:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6374:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6377:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6380:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6381:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6382:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6383:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6384:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6393:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6565:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6594:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6595:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6649:Gpat2 UTSW 2 127432435 missense possibly damaging 0.81
R6665:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6666:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6667:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6668:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6669:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R7031:Gpat2 UTSW 2 127435475 missense probably damaging 0.99
R7096:Gpat2 UTSW 2 127428289 missense probably benign 0.02
R7307:Gpat2 UTSW 2 127434890 missense probably damaging 1.00
R7313:Gpat2 UTSW 2 127428295 missense probably damaging 0.99
R7365:Gpat2 UTSW 2 127426981 intron probably null
Predicted Primers PCR Primer
(F):5'- TGGACAACTCAGAGGGCATC -3'
(R):5'- CATTGTGCCACCCAGAACTG -3'

Sequencing Primer
(F):5'- AACTCAGAGGGCATCCTTGC -3'
(R):5'- GGTTGATAATCTACTCGGATCCCAG -3'
Posted On2018-05-04