Incidental Mutation 'R6375:Olfr706'
ID514916
Institutional Source Beutler Lab
Gene Symbol Olfr706
Ensembl Gene ENSMUSG00000109354
Gene Nameolfactory receptor 706
SynonymsGA_x6K02T2PBJ9-9271198-9270248, MOR283-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6375 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106882589-106888162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106886014 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 268 (A268S)
Ref Sequence ENSEMBL: ENSMUSP00000150075 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000209025
AA Change: A268S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect probably benign
Transcript: ENSMUST00000213918
AA Change: A268S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216099
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,562 I797N possibly damaging Het
Actbl2 A G 13: 111,255,944 E271G probably damaging Het
Aplp2 T C 9: 31,157,788 N526D probably benign Het
Cacna1e A C 1: 154,479,305 N389K probably damaging Het
Ccdc18 T C 5: 108,174,954 I640T possibly damaging Het
Ccdc39 T A 3: 33,814,367 T857S probably benign Het
Ccser1 T A 6: 61,311,168 L105* probably null Het
Efhc1 T A 1: 20,972,940 M361K probably benign Het
Eml5 T C 12: 98,798,868 Het
Fgfr2 C A 7: 130,167,745 L637F probably damaging Het
Fmo9 A G 1: 166,664,595 probably null Het
Gm4302 A G 10: 100,341,396 T181A probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hoxb4 A G 11: 96,320,327 *251W probably null Het
Il1r1 T A 1: 40,294,890 Y207N probably damaging Het
Kcnc2 C T 10: 112,463,189 T622M possibly damaging Het
Kcnk9 C T 15: 72,546,243 A13T probably benign Het
Kdm4c C T 4: 74,330,715 P69S probably damaging Het
Kmt2e T C 5: 23,499,519 S1237P probably benign Het
Lrrc37a G A 11: 103,501,089 T1170I probably benign Het
Lyn T A 4: 3,745,527 F109I probably damaging Het
Lynx1 T C 15: 74,751,319 Y88C probably damaging Het
Mon1b T A 8: 113,638,077 I162N probably damaging Het
Muc4 A G 16: 32,736,243 probably benign Het
Nbn T A 4: 15,979,327 F437L probably benign Het
Neil3 T C 8: 53,587,276 K564E possibly damaging Het
Nfe2l1 A T 11: 96,820,051 S293T probably damaging Het
Olfr121 T A 17: 37,752,099 S82T probably benign Het
Olfr292 C T 7: 86,695,059 A201V probably benign Het
Olfr577 T C 7: 102,973,753 T80A probably damaging Het
Pcdhb22 A T 18: 37,518,304 probably benign Het
Pcdhgb6 A G 18: 37,742,625 N129D probably damaging Het
Pias2 C T 18: 77,152,670 T574M possibly damaging Het
Plec G A 15: 76,177,640 T2564I probably damaging Het
Qrich2 A G 11: 116,458,228 probably benign Het
Scgb1b12 T A 7: 32,334,459 V48E probably damaging Het
Scn5a A T 9: 119,543,356 L224Q probably damaging Het
Snx3 T A 10: 42,534,731 Y132* probably null Het
Stk39 T A 2: 68,392,238 I161F probably benign Het
Tcaf2 A C 6: 42,626,178 L816R probably damaging Het
Thap4 C A 1: 93,725,156 probably null Het
Tmc5 T A 7: 118,656,814 V704E probably damaging Het
Tmem39a A G 16: 38,585,237 T59A probably benign Het
Tshz2 A G 2: 169,886,019 N376S probably damaging Het
Vmn1r60 T C 7: 5,545,018 N28D probably damaging Het
Zfp637 C T 6: 117,845,324 R138W probably damaging Het
Other mutations in Olfr706
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02311:Olfr706 APN 7 106885894 missense probably benign 0.00
IGL03093:Olfr706 APN 7 106886203 missense probably benign 0.02
IGL03354:Olfr706 APN 7 106886100 missense probably benign 0.07
R0334:Olfr706 UTSW 7 106886415 missense probably benign 0.00
R1577:Olfr706 UTSW 7 106886010 missense probably benign 0.03
R4083:Olfr706 UTSW 7 106886644 missense probably damaging 0.97
R4399:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R4421:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R5202:Olfr706 UTSW 7 106886596 missense possibly damaging 0.90
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6475:Olfr706 UTSW 7 106886397 missense probably benign 0.00
R7665:Olfr706 UTSW 7 106886673 missense possibly damaging 0.95
R7742:Olfr706 UTSW 7 106886622 missense probably damaging 1.00
R7956:Olfr706 UTSW 7 106885971 missense possibly damaging 0.88
Z1088:Olfr706 UTSW 7 106886296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTCTACCTTGGTAATTCATCCAG -3'
(R):5'- TGACAGGGGTGACATTCCTC -3'

Sequencing Primer
(F):5'- ATTCATCCAGATACTTTCCAATCAC -3'
(R):5'- GACAGGGGTGACATTCCTCTTACTC -3'
Posted On2018-05-04