Incidental Mutation 'R6375:Hoxb4'
ID514926
Institutional Source Beutler Lab
Gene Symbol Hoxb4
Ensembl Gene ENSMUSG00000038692
Gene Namehomeobox B4
SynonymsHox-2.6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R6375 (G1)
Quality Score109.008
Status Validated
Chromosome11
Chromosomal Location96318267-96321638 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 96320327 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 251 (*251W)
Ref Sequence ENSEMBL: ENSMUSP00000048002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049241] [ENSMUST00000093944]
Predicted Effect probably null
Transcript: ENSMUST00000049241
AA Change: *251W
SMART Domains Protein: ENSMUSP00000048002
Gene: ENSMUSG00000038692
AA Change: *251W

DomainStartEndE-ValueType
low complexity region 71 87 N/A INTRINSIC
low complexity region 113 120 N/A INTRINSIC
HOX 161 223 2.83e-26 SMART
low complexity region 230 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083585
Predicted Effect probably benign
Transcript: ENSMUST00000093944
SMART Domains Protein: ENSMUSP00000091476
Gene: ENSMUSG00000048763

DomainStartEndE-ValueType
low complexity region 76 121 N/A INTRINSIC
low complexity region 154 181 N/A INTRINSIC
HOX 191 253 5.44e-28 SMART
low complexity region 256 274 N/A INTRINSIC
Pfam:DUF4074 368 431 1.9e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Intracellular or ectopic expression of this protein expands hematopoietic stem and progenitor cells in vivo and in vitro, making it a potential candidate for therapeutic stem cell expansion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes cervical vertebral transformation and may lead to pre- or neonatal lethality, sternal defects, impaired ventral body wall formation, diaphragm hernias and heart anomalies. Homozygotes for a null allele show a proliferation defect in hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,562 I797N possibly damaging Het
Actbl2 A G 13: 111,255,944 E271G probably damaging Het
Aplp2 T C 9: 31,157,788 N526D probably benign Het
Cacna1e A C 1: 154,479,305 N389K probably damaging Het
Ccdc18 T C 5: 108,174,954 I640T possibly damaging Het
Ccdc39 T A 3: 33,814,367 T857S probably benign Het
Ccser1 T A 6: 61,311,168 L105* probably null Het
Efhc1 T A 1: 20,972,940 M361K probably benign Het
Eml5 T C 12: 98,798,868 Het
Fgfr2 C A 7: 130,167,745 L637F probably damaging Het
Fmo9 A G 1: 166,664,595 probably null Het
Gm4302 A G 10: 100,341,396 T181A probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Il1r1 T A 1: 40,294,890 Y207N probably damaging Het
Kcnc2 C T 10: 112,463,189 T622M possibly damaging Het
Kcnk9 C T 15: 72,546,243 A13T probably benign Het
Kdm4c C T 4: 74,330,715 P69S probably damaging Het
Kmt2e T C 5: 23,499,519 S1237P probably benign Het
Lrrc37a G A 11: 103,501,089 T1170I probably benign Het
Lyn T A 4: 3,745,527 F109I probably damaging Het
Lynx1 T C 15: 74,751,319 Y88C probably damaging Het
Mon1b T A 8: 113,638,077 I162N probably damaging Het
Muc4 A G 16: 32,736,243 probably benign Het
Nbn T A 4: 15,979,327 F437L probably benign Het
Neil3 T C 8: 53,587,276 K564E possibly damaging Het
Nfe2l1 A T 11: 96,820,051 S293T probably damaging Het
Olfr121 T A 17: 37,752,099 S82T probably benign Het
Olfr292 C T 7: 86,695,059 A201V probably benign Het
Olfr577 T C 7: 102,973,753 T80A probably damaging Het
Olfr706 C A 7: 106,886,014 A268S probably benign Het
Pcdhb22 A T 18: 37,518,304 probably benign Het
Pcdhgb6 A G 18: 37,742,625 N129D probably damaging Het
Pias2 C T 18: 77,152,670 T574M possibly damaging Het
Plec G A 15: 76,177,640 T2564I probably damaging Het
Qrich2 A G 11: 116,458,228 probably benign Het
Scgb1b12 T A 7: 32,334,459 V48E probably damaging Het
Scn5a A T 9: 119,543,356 L224Q probably damaging Het
Snx3 T A 10: 42,534,731 Y132* probably null Het
Stk39 T A 2: 68,392,238 I161F probably benign Het
Tcaf2 A C 6: 42,626,178 L816R probably damaging Het
Thap4 C A 1: 93,725,156 probably null Het
Tmc5 T A 7: 118,656,814 V704E probably damaging Het
Tmem39a A G 16: 38,585,237 T59A probably benign Het
Tshz2 A G 2: 169,886,019 N376S probably damaging Het
Vmn1r60 T C 7: 5,545,018 N28D probably damaging Het
Zfp637 C T 6: 117,845,324 R138W probably damaging Het
Other mutations in Hoxb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Hoxb4 APN 11 96318900 missense probably damaging 1.00
IGL02642:Hoxb4 APN 11 96320224 missense probably damaging 1.00
R0586:Hoxb4 UTSW 11 96318887 missense probably damaging 0.99
R1548:Hoxb4 UTSW 11 96318899 nonsense probably null
R1634:Hoxb4 UTSW 11 96320273 unclassified probably benign
R1932:Hoxb4 UTSW 11 96320041 missense probably damaging 1.00
R4571:Hoxb4 UTSW 11 96319166 missense possibly damaging 0.95
R4879:Hoxb4 UTSW 11 96320188 missense probably damaging 1.00
R4930:Hoxb4 UTSW 11 96318836 missense probably damaging 1.00
R5502:Hoxb4 UTSW 11 96320231 missense probably damaging 1.00
R6082:Hoxb4 UTSW 11 96318533 unclassified probably benign
R6823:Hoxb4 UTSW 11 96318654 unclassified probably benign
R7217:Hoxb4 UTSW 11 96319080 missense probably benign 0.02
R7256:Hoxb4 UTSW 11 96319896 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTACAATCGCTACCTGACG -3'
(R):5'- ACTCGAATCTTGTCTCCGAAG -3'

Sequencing Primer
(F):5'- CGGAGGGTGGAGATCGC -3'
(R):5'- AAGGACTTTACCCGGCTCC -3'
Posted On2018-05-04