Incidental Mutation 'R6375:Qrich2'
ID514929
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6375 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 116458228 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134182
SMART Domains Protein: ENSMUSP00000115947
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
Blast:MYSc 1 287 4e-80 BLAST
coiled coil region 336 351 N/A INTRINSIC
low complexity region 602 622 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208602
AA Change: V590A
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,562 I797N possibly damaging Het
Actbl2 A G 13: 111,255,944 E271G probably damaging Het
Aplp2 T C 9: 31,157,788 N526D probably benign Het
Cacna1e A C 1: 154,479,305 N389K probably damaging Het
Ccdc18 T C 5: 108,174,954 I640T possibly damaging Het
Ccdc39 T A 3: 33,814,367 T857S probably benign Het
Ccser1 T A 6: 61,311,168 L105* probably null Het
Efhc1 T A 1: 20,972,940 M361K probably benign Het
Eml5 T C 12: 98,798,868 Het
Fgfr2 C A 7: 130,167,745 L637F probably damaging Het
Fmo9 A G 1: 166,664,595 probably null Het
Gm4302 A G 10: 100,341,396 T181A probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hoxb4 A G 11: 96,320,327 *251W probably null Het
Il1r1 T A 1: 40,294,890 Y207N probably damaging Het
Kcnc2 C T 10: 112,463,189 T622M possibly damaging Het
Kcnk9 C T 15: 72,546,243 A13T probably benign Het
Kdm4c C T 4: 74,330,715 P69S probably damaging Het
Kmt2e T C 5: 23,499,519 S1237P probably benign Het
Lrrc37a G A 11: 103,501,089 T1170I probably benign Het
Lyn T A 4: 3,745,527 F109I probably damaging Het
Lynx1 T C 15: 74,751,319 Y88C probably damaging Het
Mon1b T A 8: 113,638,077 I162N probably damaging Het
Muc4 A G 16: 32,736,243 probably benign Het
Nbn T A 4: 15,979,327 F437L probably benign Het
Neil3 T C 8: 53,587,276 K564E possibly damaging Het
Nfe2l1 A T 11: 96,820,051 S293T probably damaging Het
Olfr121 T A 17: 37,752,099 S82T probably benign Het
Olfr292 C T 7: 86,695,059 A201V probably benign Het
Olfr577 T C 7: 102,973,753 T80A probably damaging Het
Olfr706 C A 7: 106,886,014 A268S probably benign Het
Pcdhb22 A T 18: 37,518,304 probably benign Het
Pcdhgb6 A G 18: 37,742,625 N129D probably damaging Het
Pias2 C T 18: 77,152,670 T574M possibly damaging Het
Plec G A 15: 76,177,640 T2564I probably damaging Het
Scgb1b12 T A 7: 32,334,459 V48E probably damaging Het
Scn5a A T 9: 119,543,356 L224Q probably damaging Het
Snx3 T A 10: 42,534,731 Y132* probably null Het
Stk39 T A 2: 68,392,238 I161F probably benign Het
Tcaf2 A C 6: 42,626,178 L816R probably damaging Het
Thap4 C A 1: 93,725,156 probably null Het
Tmc5 T A 7: 118,656,814 V704E probably damaging Het
Tmem39a A G 16: 38,585,237 T59A probably benign Het
Tshz2 A G 2: 169,886,019 N376S probably damaging Het
Vmn1r60 T C 7: 5,545,018 N28D probably damaging Het
Zfp637 C T 6: 117,845,324 R138W probably damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7916:Qrich2 UTSW 11 116455765 missense probably benign 0.04
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTGAACCCAAACAGGCTG -3'
(R):5'- AGTCCAGCTTAACGTCACGC -3'

Sequencing Primer
(F):5'- TAGACCTTGCTGATCTGCACCAAG -3'
(R):5'- ACGCTTTATACAACCTGGTGCAG -3'
Posted On2018-05-04