Incidental Mutation 'R6376:Dnah14'
ID 514950
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 044526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6376 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 181433459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 379 (P379S)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000208001
AA Change: P379S

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,339,456 (GRCm39) E106D probably damaging Het
A830018L16Rik A T 1: 11,868,718 (GRCm39) N333Y probably damaging Het
Abca4 T A 3: 121,917,309 (GRCm39) M1007K possibly damaging Het
Accsl T A 2: 93,687,343 (GRCm39) I495F probably damaging Het
Acsl3 T C 1: 78,674,182 (GRCm39) S373P possibly damaging Het
Adam7 A G 14: 68,742,546 (GRCm39) I689T possibly damaging Het
Akap11 G A 14: 78,752,336 (GRCm39) T179I probably damaging Het
Ankmy1 T C 1: 92,816,187 (GRCm39) K309R possibly damaging Het
Apaf1 A T 10: 90,859,673 (GRCm39) I824N probably damaging Het
Apc2 T A 10: 80,148,488 (GRCm39) C1152S probably damaging Het
Arhgap17 C A 7: 122,899,727 (GRCm39) W409L probably damaging Het
Arhgef15 T C 11: 68,845,796 (GRCm39) I19V unknown Het
Arnt C A 3: 95,397,936 (GRCm39) P573H probably damaging Het
Arvcf G A 16: 18,223,882 (GRCm39) G932R probably damaging Het
Atg4a-ps C T 3: 103,553,044 (GRCm39) W99* probably null Het
Atp13a5 T A 16: 29,056,004 (GRCm39) D1052V probably benign Het
Atp2b4 T C 1: 133,642,797 (GRCm39) T1103A probably damaging Het
B4galnt4 C A 7: 140,647,335 (GRCm39) Q362K possibly damaging Het
Cd320 T A 17: 34,066,491 (GRCm39) N90K probably benign Het
Cep170b A T 12: 112,698,502 (GRCm39) I87F probably damaging Het
Coq3 T G 4: 21,900,486 (GRCm39) C238G probably benign Het
Cpa5 A T 6: 30,614,044 (GRCm39) Q62L probably benign Het
Ctsg A T 14: 56,339,110 (GRCm39) C49* probably null Het
Cul9 T C 17: 46,819,489 (GRCm39) T2000A probably damaging Het
Dedd C T 1: 171,167,790 (GRCm39) P155S probably benign Het
Dnah1 A G 14: 30,997,565 (GRCm39) S2598P probably damaging Het
Dync2h1 A T 9: 7,165,703 (GRCm39) S519R probably benign Het
Eea1 A G 10: 95,874,660 (GRCm39) S1192G probably benign Het
Eif5b T C 1: 38,084,760 (GRCm39) I869T probably damaging Het
Elavl4 C A 4: 110,112,651 (GRCm39) probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Ets2 G A 16: 95,520,037 (GRCm39) R421H probably damaging Het
Exoc3l2 G A 7: 19,203,635 (GRCm39) A76T possibly damaging Het
Fam89b T C 19: 5,778,757 (GRCm39) Y144C probably damaging Het
Greb1 T C 12: 16,749,580 (GRCm39) E1082G probably damaging Het
Gtf3a A T 5: 146,890,798 (GRCm39) probably null Het
Hoxc12 C A 15: 102,845,524 (GRCm39) F79L possibly damaging Het
Hspb8 G T 5: 116,547,491 (GRCm39) L164I probably damaging Het
Ina C T 19: 47,003,564 (GRCm39) A124V probably benign Het
Inhbb T A 1: 119,345,411 (GRCm39) I293F probably damaging Het
Itpr3 A G 17: 27,314,449 (GRCm39) Y633C possibly damaging Het
Jag2 C T 12: 112,872,949 (GRCm39) V1102I probably benign Het
Kalrn A T 16: 33,796,361 (GRCm39) F1138Y probably benign Het
Large2 T A 2: 92,200,853 (GRCm39) probably benign Het
Lats2 A G 14: 57,959,966 (GRCm39) S177P probably benign Het
Lims2 G A 18: 32,087,515 (GRCm39) R124H possibly damaging Het
Lrp2 T A 2: 69,313,787 (GRCm39) T2315S probably benign Het
Lrrc4c A C 2: 97,459,391 (GRCm39) T6P probably benign Het
Lrrk2 T C 15: 91,626,469 (GRCm39) L1171S possibly damaging Het
Man2b2 A T 5: 36,978,378 (GRCm39) M302K probably damaging Het
Mocos G A 18: 24,834,542 (GRCm39) G860R possibly damaging Het
Mylk3 T A 8: 86,085,571 (GRCm39) D258V possibly damaging Het
Nkx1-2 C T 7: 132,201,240 (GRCm39) D6N probably damaging Het
Nrp2 A G 1: 62,758,176 (GRCm39) N54S possibly damaging Het
Nt5el T C 13: 105,256,473 (GRCm39) I514T possibly damaging Het
Or2d2 A G 7: 106,727,848 (GRCm39) F251L probably benign Het
Pacsin1 A T 17: 27,926,879 (GRCm39) T195S probably benign Het
Pank4 T C 4: 155,056,693 (GRCm39) probably null Het
Pdgfra A T 5: 75,327,180 (GRCm39) M126L probably benign Het
Podxl T A 6: 31,505,432 (GRCm39) T204S probably benign Het
Pole G A 5: 110,484,240 (GRCm39) D2175N probably damaging Het
Pramel16 C T 4: 143,677,267 (GRCm39) G104E probably benign Het
Prkdc A G 16: 15,587,749 (GRCm39) K2545E probably benign Het
Prodh T C 16: 17,897,849 (GRCm39) I183V probably benign Het
Ptch1 T C 13: 63,691,422 (GRCm39) D277G possibly damaging Het
Rapgef5 G A 12: 117,684,988 (GRCm39) V246M probably damaging Het
Rubcnl A G 14: 75,269,834 (GRCm39) N164S probably benign Het
Samd4 A T 14: 47,290,419 (GRCm39) L175F probably damaging Het
Scart1 G A 7: 139,808,642 (GRCm39) G851D probably damaging Het
Scimp C A 11: 70,688,893 (GRCm39) W41L possibly damaging Het
Scn3a T A 2: 65,291,843 (GRCm39) K1634N possibly damaging Het
Spta1 A G 1: 174,030,888 (GRCm39) R957G probably benign Het
Sptlc3 T A 2: 139,478,692 (GRCm39) N550K probably benign Het
Srebf1 T C 11: 60,094,361 (GRCm39) N609D probably null Het
Styxl1 A T 5: 135,776,664 (GRCm39) L164H probably benign Het
Synpo2l A T 14: 20,710,702 (GRCm39) D865E probably damaging Het
Tnfsf15 T C 4: 63,663,267 (GRCm39) M19V probably damaging Het
Trappc8 G C 18: 20,970,132 (GRCm39) R953G probably benign Het
Trav13-1 A G 14: 53,782,800 (GRCm39) N50S probably benign Het
Trim12a T C 7: 103,955,241 (GRCm39) K161E probably benign Het
Vipr1 C A 9: 121,493,640 (GRCm39) N230K probably damaging Het
Xirp1 A T 9: 119,847,557 (GRCm39) V3E probably damaging Het
Zfp768 A G 7: 126,943,892 (GRCm39) F82L probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCAAAACCGTCTGAAATCAAC -3'
(R):5'- CAGGAACAAAATCTGCTCAGG -3'

Sequencing Primer
(F):5'- TCAACACAACACATTTTAAGCTGC -3'
(R):5'- CTTCACTTCATGGACATCTTAAAGG -3'
Posted On 2018-05-04