Incidental Mutation 'R6376:Scn3a'
ID514951
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65461499 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1634 (K1634N)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066432
AA Change: K1634N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: K1634N

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100069
AA Change: K1634N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: K1634N

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Kalrn A T 16: 33,975,991 F1138Y probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Pdgfra A T 5: 75,166,519 M126L probably benign Het
Podxl T A 6: 31,528,497 T204S probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Styxl1 A T 5: 135,747,810 L164H probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Vipr1 C A 9: 121,664,574 N230K probably damaging Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense not run
Predicted Primers PCR Primer
(F):5'- TTCACTGAGCTTCCAGGGTG -3'
(R):5'- TTCCTTGCTGAGCTGATAGAGAAG -3'

Sequencing Primer
(F):5'- TGAATTGCATCAGGGTCACAGTC -3'
(R):5'- AGAGAAGTATTTTGTGTCTCCTACCC -3'
Posted On2018-05-04