Incidental Mutation 'R6376:Pdgfra'
ID514965
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75166519 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 126 (M126L)
Ref Sequence ENSEMBL: ENSMUSP00000144132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162] [ENSMUST00000200822] [ENSMUST00000201711] [ENSMUST00000202161] [ENSMUST00000202186] [ENSMUST00000202681] [ENSMUST00000202992]
Predicted Effect probably benign
Transcript: ENSMUST00000000476
AA Change: M126L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168162
AA Change: M126L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200822
AA Change: M126L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144634
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
IG_like 135 206 7e-2 SMART
Blast:IG 220 243 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201241
Predicted Effect probably benign
Transcript: ENSMUST00000201711
AA Change: M126L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143891
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202161
SMART Domains Protein: ENSMUSP00000144485
Gene: ENSMUSG00000029231

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:IG 34 88 5e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202186
AA Change: M126L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144543
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
IG_like 135 206 7e-2 SMART
IGc2 226 297 3.6e-6 SMART
IG 322 414 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202681
AA Change: M126L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143906
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202992
AA Change: M126L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144132
Gene: ENSMUSG00000029231
AA Change: M126L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Kalrn A T 16: 33,975,991 F1138Y probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Podxl T A 6: 31,528,497 T204S probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Scn3a T A 2: 65,461,499 K1634N possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Styxl1 A T 5: 135,747,810 L164H probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Vipr1 C A 9: 121,664,574 N230K probably damaging Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
Pony_express UTSW 5 75189234 nonsense probably null
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
R7347:Pdgfra UTSW 5 75183098 missense possibly damaging 0.91
R7476:Pdgfra UTSW 5 75170603 missense probably damaging 1.00
R7512:Pdgfra UTSW 5 75195014 nonsense probably null
R7609:Pdgfra UTSW 5 75166721 missense probably benign 0.10
R7925:Pdgfra UTSW 5 75192418 splice site probably benign
R8141:Pdgfra UTSW 5 75177726 missense possibly damaging 0.81
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Z1177:Pdgfra UTSW 5 75181674 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGGTGTTTAGAATGTCAC -3'
(R):5'- AAACTCGCTGGTCTTGAACG -3'

Sequencing Primer
(F):5'- AGAATGTCACTTTAATGCTACACAG -3'
(R):5'- TGGCCTCACAGATGTAAGGC -3'
Posted On2018-05-04