Incidental Mutation 'R6376:Styxl1'
ID514968
Institutional Source Beutler Lab
Gene Symbol Styxl1
Ensembl Gene ENSMUSG00000019178
Gene Nameserine/threonine/tyrosine interacting-like 1
Synonyms1700011C14Rik, Dusp24
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135747220-135778385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135747810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 164 (L164H)
Ref Sequence ENSEMBL: ENSMUSP00000137191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043378] [ENSMUST00000053906] [ENSMUST00000111161] [ENSMUST00000111162] [ENSMUST00000111163] [ENSMUST00000111164] [ENSMUST00000142343] [ENSMUST00000153399] [ENSMUST00000177559] [ENSMUST00000178515]
Predicted Effect probably benign
Transcript: ENSMUST00000043378
SMART Domains Protein: ENSMUSP00000045252
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 13 336 4.2e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053906
AA Change: L308H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000051216
Gene: ENSMUSG00000019178
AA Change: L308H

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111161
AA Change: L164H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106791
Gene: ENSMUSG00000019178
AA Change: L164H

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111162
AA Change: L204H
SMART Domains Protein: ENSMUSP00000106792
Gene: ENSMUSG00000019178
AA Change: L204H

DomainStartEndE-ValueType
Pfam:DSPc 64 203 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111163
AA Change: L308H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106793
Gene: ENSMUSG00000019178
AA Change: L308H

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111164
AA Change: L308H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106794
Gene: ENSMUSG00000019178
AA Change: L308H

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142343
SMART Domains Protein: ENSMUSP00000136983
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
Blast:RHOD 17 62 8e-19 BLAST
SCOP:d1gmxa_ 23 67 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153399
SMART Domains Protein: ENSMUSP00000120834
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 12 93 9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177559
AA Change: L308H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135982
Gene: ENSMUSG00000019178
AA Change: L308H

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178515
AA Change: L164H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137191
Gene: ENSMUSG00000019178
AA Change: L164H

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Kalrn A T 16: 33,975,991 F1138Y probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Pdgfra A T 5: 75,166,519 M126L probably benign Het
Podxl T A 6: 31,528,497 T204S probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Scn3a T A 2: 65,461,499 K1634N possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Vipr1 C A 9: 121,664,574 N230K probably damaging Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Styxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Styxl1 APN 5 135765750 missense probably damaging 1.00
IGL02735:Styxl1 APN 5 135759142 missense probably damaging 1.00
IGL03284:Styxl1 APN 5 135757095 missense possibly damaging 0.65
R1263:Styxl1 UTSW 5 135753883 missense probably damaging 1.00
R1533:Styxl1 UTSW 5 135770321 missense probably damaging 1.00
R1987:Styxl1 UTSW 5 135757122 missense probably damaging 1.00
R2399:Styxl1 UTSW 5 135747781 missense possibly damaging 0.80
R3040:Styxl1 UTSW 5 135757033 missense probably damaging 1.00
R3411:Styxl1 UTSW 5 135765764 missense probably damaging 1.00
R4085:Styxl1 UTSW 5 135759165 missense unknown
R4772:Styxl1 UTSW 5 135768901 nonsense probably null
R5667:Styxl1 UTSW 5 135757123 unclassified probably null
R6601:Styxl1 UTSW 5 135755496 missense probably benign 0.30
R7588:Styxl1 UTSW 5 135770276 missense probably damaging 0.98
R7735:Styxl1 UTSW 5 135759169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAAGATGCAGATATGAACCTCCAG -3'
(R):5'- GCGTCTGCATCTAGTCTTAAGCC -3'

Sequencing Primer
(F):5'- AGGCAGCAAAGGTCTTCTC -3'
(R):5'- GCATCTAGTCTTAAGCCATCATGTG -3'
Posted On2018-05-04