Incidental Mutation 'R6376:Kalrn'
ID515013
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33975991 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1138 (F1138Y)
Ref Sequence ENSEMBL: ENSMUSP00000110624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: F2807Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: F2807Y

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114973
AA Change: F1138Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: F1138Y

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132002
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Pdgfra A T 5: 75,166,519 M126L probably benign Het
Podxl T A 6: 31,528,497 T204S probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Scn3a T A 2: 65,461,499 K1634N possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Styxl1 A T 5: 135,747,810 L164H probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Vipr1 C A 9: 121,664,574 N230K probably damaging Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
Hidden UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
R7772:Kalrn UTSW 16 34031582 missense probably benign 0.04
R7796:Kalrn UTSW 16 34187484 nonsense probably null
RF014:Kalrn UTSW 16 34039933 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTGCTCACACCGCAGAAG -3'
(R):5'- GTTAGCTAACAGATTGCAGCTGGG -3'

Sequencing Primer
(F):5'- GGGAAGCTAAAGTCCACCCTG -3'
(R):5'- CAGATTGCAGCTGGGGTAGG -3'
Posted On2018-05-04