Incidental Mutation 'R6377:Pot1a'
ID 515042
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6377 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25778870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000131928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115327] [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect probably benign
Transcript: ENSMUST00000115327
AA Change: V75A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110982
Gene: ENSMUSG00000029676
AA Change: V75A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115329
SMART Domains Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115330
AA Change: V75A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: V75A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156985
Predicted Effect probably benign
Transcript: ENSMUST00000166445
AA Change: V75A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: V75A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Cyp4a14 A G 4: 115,496,083 Y11H probably benign Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Igf1r A T 7: 68,201,250 Y931F probably benign Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Kif5b A T 18: 6,212,562 L754Q probably damaging Het
Ksr1 C T 11: 79,036,494 probably null Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Loxhd1 T A 18: 77,380,432 D925E probably damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Mtbp A G 15: 55,557,620 M1V probably null Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8078:Pot1a UTSW 6 25750108 missense probably benign 0.13
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
R9070:Pot1a UTSW 6 25744630 missense
R9525:Pot1a UTSW 6 25745917 missense probably benign 0.06
R9574:Pot1a UTSW 6 25775719 missense not run
Predicted Primers PCR Primer
(F):5'- TCTAGCTACTAATGAAGCCTGATAC -3'
(R):5'- GCTAAAGGTTAAATTCAGAGCCTTGC -3'

Sequencing Primer
(F):5'- CTGTTAGTGAACAATGCAGC -3'
(R):5'- AGCCTTGCTCATGTTAGGCAAAC -3'
Posted On 2018-05-04