Incidental Mutation 'R6377:Igf1r'
ID515050
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6377 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68201250 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 931 (Y931F)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably benign
Transcript: ENSMUST00000005671
AA Change: Y931F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Y931F

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Cyp4a14 A G 4: 115,496,083 Y11H probably benign Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Kif5b A T 18: 6,212,562 L754Q probably damaging Het
Ksr1 C T 11: 79,036,494 probably null Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Loxhd1 T A 18: 77,380,432 D925E probably damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Mtbp A G 15: 55,557,620 M1V probably null Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Pot1a A G 6: 25,778,870 V75A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTTGTCCCAGCACTAGAAG -3'
(R):5'- AATGTCTGACTAGGAACTCTGGC -3'

Sequencing Primer
(F):5'- GAAGACTCCTCGAAGACTCCTCTTG -3'
(R):5'- ATGGTATTTTCCCCCACAGACGAG -3'
Posted On2018-05-04