Incidental Mutation 'R6377:Atp2c2'
ID 515057
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 044527-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6377 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120453093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 159 (E159G)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000095171
AA Change: E159G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: E159G

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212454
Meta Mutation Damage Score 0.1909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,743,855 (GRCm39) S812P possibly damaging Het
Atrn A G 2: 130,821,889 (GRCm39) I861V probably damaging Het
Clip1 A G 5: 123,741,717 (GRCm39) V1053A possibly damaging Het
Cngb1 C A 8: 95,975,608 (GRCm39) G629C probably damaging Het
Cntn5 A T 9: 9,743,657 (GRCm39) F540Y probably damaging Het
Cpb1 A C 3: 20,329,748 (GRCm39) probably null Het
Cyp4a14 A G 4: 115,353,280 (GRCm39) Y11H probably benign Het
Dact2 A G 17: 14,419,450 (GRCm39) S103P probably damaging Het
Dcstamp A T 15: 39,618,317 (GRCm39) Y242F probably benign Het
Drd3 G T 16: 43,641,670 (GRCm39) G329* probably null Het
Duxf1 T C 10: 58,059,494 (GRCm39) probably benign Het
Dysf T A 6: 83,985,945 (GRCm39) S17T probably benign Het
Eno1 A T 4: 150,333,009 (GRCm39) K366N possibly damaging Het
Ffar2 C T 7: 30,518,971 (GRCm39) V190I probably benign Het
Fkbp15 T C 4: 62,242,429 (GRCm39) T508A probably damaging Het
Fndc1 A G 17: 7,988,567 (GRCm39) V1165A unknown Het
Foxj3 A T 4: 119,430,945 (GRCm39) probably null Het
Gabarap T C 11: 69,882,630 (GRCm39) probably null Het
Gm19410 T A 8: 36,270,736 (GRCm39) L1221* probably null Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Igf1r A T 7: 67,850,998 (GRCm39) Y931F probably benign Het
Il23r A T 6: 67,400,636 (GRCm39) S565T probably damaging Het
Ipo8 A T 6: 148,717,995 (GRCm39) Y209* probably null Het
Jph2 C T 2: 163,181,632 (GRCm39) G511R probably benign Het
Khdrbs1 C A 4: 129,635,890 (GRCm39) D22Y probably damaging Het
Kif5b A T 18: 6,212,562 (GRCm39) L754Q probably damaging Het
Ksr1 C T 11: 78,927,320 (GRCm39) probably null Het
L3mbtl4 G T 17: 69,084,918 (GRCm39) V610F probably benign Het
Lars2 A G 9: 123,283,825 (GRCm39) T698A probably benign Het
Lonp1 A G 17: 56,928,961 (GRCm39) V267A possibly damaging Het
Loxhd1 T A 18: 77,468,128 (GRCm39) D925E probably damaging Het
Lsg1 A G 16: 30,393,386 (GRCm39) L187P possibly damaging Het
Mki67 A T 7: 135,298,050 (GRCm39) V2328E possibly damaging Het
Mlh3 A G 12: 85,315,271 (GRCm39) I305T probably damaging Het
Mtbp A G 15: 55,421,016 (GRCm39) M1V probably null Het
Myadml2 C A 11: 120,538,538 (GRCm39) C99F probably benign Het
Ncbp1 A G 4: 46,150,703 (GRCm39) Y185C probably damaging Het
Ndufaf7 A T 17: 79,250,739 (GRCm39) Q222L probably null Het
Nlrp4b A T 7: 10,449,339 (GRCm39) Y147F probably benign Het
Or4c11c C T 2: 88,661,613 (GRCm39) R51* probably null Het
Pet100 T C 8: 3,672,370 (GRCm39) V15A probably benign Het
Pot1a A G 6: 25,778,869 (GRCm39) V75A probably benign Het
Ptprs A T 17: 56,725,935 (GRCm39) M1043K probably damaging Het
Rnf31 A G 14: 55,832,984 (GRCm39) T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Rubcnl A T 14: 75,287,635 (GRCm39) probably null Het
Ryr3 A T 2: 112,462,530 (GRCm39) C4839S probably damaging Het
Scai A C 2: 38,992,340 (GRCm39) D379E probably benign Het
Scd2 G T 19: 44,288,198 (GRCm39) G197* probably null Het
Sdr39u1 A C 14: 56,135,166 (GRCm39) I259S probably benign Het
Slco1a5 A T 6: 142,187,906 (GRCm39) probably null Het
Sp1 A T 15: 102,339,318 (GRCm39) T733S probably benign Het
Tecta A G 9: 42,255,051 (GRCm39) S1711P probably damaging Het
Tedc1 G T 12: 113,124,975 (GRCm39) W240L probably damaging Het
Trarg1 T C 11: 76,571,355 (GRCm39) S124P probably damaging Het
Trim50 A G 5: 135,382,454 (GRCm39) K102R probably benign Het
Utrn A G 10: 12,619,827 (GRCm39) Y278H probably damaging Het
Vinac1 T A 2: 128,878,731 (GRCm39) D1065V unknown Het
Vmn2r109 A C 17: 20,784,796 (GRCm39) probably null Het
Zbed5 T C 5: 129,932,210 (GRCm39) S720P possibly damaging Het
Zc3h3 A G 15: 75,711,304 (GRCm39) S386P probably damaging Het
Zscan4-ps1 C T 7: 10,802,418 (GRCm39) probably null Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGTAGGGCTCACATCCCC -3'
(R):5'- AAGACTGCTCTCCCCATGTC -3'

Sequencing Primer
(F):5'- TGGCACCCTGTCTTCCAG -3'
(R):5'- TCCCCATGTCACACCATGAAGG -3'
Posted On 2018-05-04