Mutagenetix > Incidental Mutation

Incidental Mutation 'R6377:Lars2'

515060

Institutional Source

Beutler Lab

Gene Symbol

Lars2

Ensembl Gene

ENSMUSG00000035202

Gene Name

leucyl-tRNA synthetase, mitochondrial

Synonyms

Kiaa0028

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6377 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123366927-123462666 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123454760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 698 (T698A)

Ref Sequence

ENSEMBL: ENSMUSP00000036710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]

AlphaFold

Q8VDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000038863
AA Change: T698A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: T698A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	57	223	7.6e-24	PFAM
Pfam:tRNA-synt_1g	83	239	9.3e-20	PFAM
Pfam:tRNA-synt_1_2	269	430	1.1e-8	PFAM
Pfam:tRNA-synt_1	434	609	5.6e-8	PFAM
Pfam:tRNA-synt_1g	589	682	1.2e-6	PFAM
Pfam:tRNA-synt_1	633	678	1.6e-7	PFAM
Pfam:Anticodon_1	724	867	9.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215087

Predicted Effect

probably benign
Transcript: ENSMUST00000217116

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

94% (59/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankib1	A	G	5: 3,693,855	S812P	possibly damaging	Het
Atp2c2	A	G	8: 119,726,354	E159G	probably benign	Het
Atrn	A	G	2: 130,979,969	I861V	probably damaging	Het
AW822073	T	C	10: 58,223,672		probably benign	Het
Clip1	A	G	5: 123,603,654	V1053A	possibly damaging	Het
Cngb1	C	A	8: 95,248,980	G629C	probably damaging	Het
Cntn5	A	T	9: 9,743,652	F540Y	probably damaging	Het
Cpb1	A	C	3: 20,275,584		probably null	Het
Cyp4a14	A	G	4: 115,496,083	Y11H	probably benign	Het
Dact2	A	G	17: 14,199,188	S103P	probably damaging	Het
Dcstamp	A	T	15: 39,754,921	Y242F	probably benign	Het
Drd3	G	T	16: 43,821,307	G329*	probably null	Het
Dysf	T	A	6: 84,008,963	S17T	probably benign	Het
Eno1	A	T	4: 150,248,552	K366N	possibly damaging	Het
Ffar2	C	T	7: 30,819,546	V190I	probably benign	Het
Fkbp15	T	C	4: 62,324,192	T508A	probably damaging	Het
Fndc1	A	G	17: 7,769,735	V1165A	unknown	Het
Foxj3	A	T	4: 119,573,748		probably null	Het
Gabarap	T	C	11: 69,991,804		probably null	Het
Gm14025	T	A	2: 129,036,811	D1065V	unknown	Het
Gm19410	T	A	8: 35,803,582	L1221*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Igf1r	A	T	7: 68,201,250	Y931F	probably benign	Het
Il23r	A	T	6: 67,423,652	S565T	probably damaging	Het
Ipo8	A	T	6: 148,816,497	Y209*	probably null	Het
Jph2	C	T	2: 163,339,712	G511R	probably benign	Het
Khdrbs1	C	A	4: 129,742,097	D22Y	probably damaging	Het
Kif5b	A	T	18: 6,212,562	L754Q	probably damaging	Het
Ksr1	C	T	11: 79,036,494		probably null	Het
L3mbtl4	G	T	17: 68,777,923	V610F	probably benign	Het
Lonp1	A	G	17: 56,621,961	V267A	possibly damaging	Het
Loxhd1	T	A	18: 77,380,432	D925E	probably damaging	Het
Lsg1	A	G	16: 30,574,568	L187P	possibly damaging	Het
Mki67	A	T	7: 135,696,321	V2328E	possibly damaging	Het
Mlh3	A	G	12: 85,268,497	I305T	probably damaging	Het
Mtbp	A	G	15: 55,557,620	M1V	probably null	Het
Myadml2	C	A	11: 120,647,712	C99F	probably benign	Het
Ncbp1	A	G	4: 46,150,703	Y185C	probably damaging	Het
Ndufaf7	A	T	17: 78,943,310	Q222L	probably null	Het
Nlrp4b	A	T	7: 10,715,412	Y147F	probably benign	Het
Olfr1205	C	T	2: 88,831,269	R51*	probably null	Het
Pet100	T	C	8: 3,622,370	V15A	probably benign	Het
Pot1a	A	G	6: 25,778,870	V75A	probably benign	Het
Ptprs	A	T	17: 56,418,935	M1043K	probably damaging	Het
Rnf31	A	G	14: 55,595,527	T413A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Rubcnl	A	T	14: 75,050,195		probably null	Het
Ryr3	A	T	2: 112,632,185	C4839S	probably damaging	Het
Scai	A	C	2: 39,102,328	D379E	probably benign	Het
Scd2	G	T	19: 44,299,759	G197*	probably null	Het
Sdr39u1	A	C	14: 55,897,709	I259S	probably benign	Het
Slco1a5	A	T	6: 142,242,180		probably null	Het
Sp1	A	T	15: 102,430,883	T733S	probably benign	Het
Tecta	A	G	9: 42,343,755	S1711P	probably damaging	Het
Tedc1	G	T	12: 113,161,355	W240L	probably damaging	Het
Trim50	A	G	5: 135,353,600	K102R	probably benign	Het
Tusc5	T	C	11: 76,680,529	S124P	probably damaging	Het
Utrn	A	G	10: 12,744,083	Y278H	probably damaging	Het
Vmn2r109	A	C	17: 20,564,534		probably null	Het
Zbed5	T	C	5: 129,903,369	S720P	possibly damaging	Het
Zc3h3	A	G	15: 75,839,455	S386P	probably damaging	Het
Zscan4-ps1	C	T	7: 11,068,491		probably null	Het

Other mutations in Lars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Lars2	APN	9	123453248	missense	probably damaging	0.98
IGL01993:Lars2	APN	9	123394943	splice site	probably benign
IGL02155:Lars2	APN	9	123454982	missense	probably damaging	0.99
IGL02941:Lars2	APN	9	123459585	missense	probably damaging	0.97
IGL03090:Lars2	APN	9	123455960	missense	probably damaging	1.00
IGL03271:Lars2	APN	9	123459484	splice site	probably null
IGL03386:Lars2	APN	9	123453390	nonsense	probably null
IGL03410:Lars2	APN	9	123418776	missense	possibly damaging	0.87
ulrich	UTSW	9	123418693	missense	probably damaging	0.99
K3955:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
P0038:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
R0276:Lars2	UTSW	9	123438121	splice site	probably benign
R1671:Lars2	UTSW	9	123418279	missense	probably benign	0.02
R1829:Lars2	UTSW	9	123431917	missense	probably benign	0.00
R2219:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R2220:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R4610:Lars2	UTSW	9	123418693	missense	probably damaging	0.99
R5027:Lars2	UTSW	9	123441495	missense	probably benign	0.38
R5195:Lars2	UTSW	9	123453310	missense	probably damaging	0.97
R5597:Lars2	UTSW	9	123454982	missense	probably damaging	0.99
R5756:Lars2	UTSW	9	123438199	missense	probably damaging	1.00
R5783:Lars2	UTSW	9	123461596	missense	probably benign
R6045:Lars2	UTSW	9	123371988	missense	probably damaging	1.00
R6235:Lars2	UTSW	9	123411880	missense	probably damaging	1.00
R6323:Lars2	UTSW	9	123441594	nonsense	probably null
R6395:Lars2	UTSW	9	123371925	missense	probably benign	0.06
R7094:Lars2	UTSW	9	123459585	missense	probably damaging	0.99
R7144:Lars2	UTSW	9	123431993	missense	probably damaging	1.00
R7233:Lars2	UTSW	9	123411954	nonsense	probably null
R7254:Lars2	UTSW	9	123454963	missense	possibly damaging	0.93
R7350:Lars2	UTSW	9	123427480	missense	probably damaging	1.00
R7413:Lars2	UTSW	9	123459503	missense	probably benign	0.30
R7614:Lars2	UTSW	9	123395111	missense
R7683:Lars2	UTSW	9	123377830	critical splice donor site	probably null
R8000:Lars2	UTSW	9	123436244	missense	probably damaging	1.00
R8061:Lars2	UTSW	9	123459497	missense	probably benign
R8355:Lars2	UTSW	9	123454715	missense	probably damaging	1.00
R8364:Lars2	UTSW	9	123411954	nonsense	probably null
R8818:Lars2	UTSW	9	123392827	missense	possibly damaging	0.94
R9007:Lars2	UTSW	9	123431915	nonsense	probably null
R9351:Lars2	UTSW	9	123436301	missense	probably benign	0.38
Z1177:Lars2	UTSW	9	123454782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCAGGACATCAGAGATCC -3'
(R):5'- GGGCAAAGTCCTCTGTGAAATGAG -3'

Sequencing Primer
(F):5'- CCGGAAAGAAGTAGTGGCTGACTC -3'
(R):5'- CTGACCTGAGCTATGACT -3'

Posted On

2018-05-04