Incidental Mutation 'R6377:Ksr1'
ID515065
Institutional Source Beutler Lab
Gene Symbol Ksr1
Ensembl Gene ENSMUSG00000018334
Gene Namekinase suppressor of ras 1
SynonymsD11Bhm183e, B-KSR1, D11Bhm184e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6377 (G1)
Quality Score195.009
Status Validated
Chromosome11
Chromosomal Location79013440-79146407 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 79036494 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018478] [ENSMUST00000108264] [ENSMUST00000208969] [ENSMUST00000226282]
Predicted Effect probably null
Transcript: ENSMUST00000018478
SMART Domains Protein: ENSMUSP00000018478
Gene: ENSMUSG00000018334

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 2.7e-41 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase_Tyr 563 827 2.3e-48 PFAM
Pfam:Pkinase 563 828 1.5e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108264
SMART Domains Protein: ENSMUSP00000103899
Gene: ENSMUSG00000018334

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 8.9e-51 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase 563 637 1e-6 PFAM
Pfam:Pkinase_Tyr 563 637 2e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000208969
Predicted Effect probably null
Transcript: ENSMUST00000226282
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit disorganized hair follicles and a decreased susceptibility to papilloma formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Cyp4a14 A G 4: 115,496,083 Y11H probably benign Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Igf1r A T 7: 68,201,250 Y931F probably benign Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Kif5b A T 18: 6,212,562 L754Q probably damaging Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Loxhd1 T A 18: 77,380,432 D925E probably damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Mtbp A G 15: 55,557,620 M1V probably null Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Pot1a A G 6: 25,778,870 V75A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Ksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ksr1 APN 11 79027517 missense probably damaging 1.00
IGL01304:Ksr1 APN 11 79027642 missense probably damaging 1.00
IGL01482:Ksr1 APN 11 79036583 missense probably damaging 1.00
IGL01928:Ksr1 APN 11 79044839 splice site probably null
IGL02025:Ksr1 APN 11 79021450 unclassified probably null
IGL02176:Ksr1 APN 11 79020791 missense probably benign 0.00
IGL02374:Ksr1 APN 11 79028491 missense probably benign 0.02
IGL02511:Ksr1 APN 11 79045220 missense possibly damaging 0.55
IGL02563:Ksr1 APN 11 79044858 missense possibly damaging 0.73
IGL02662:Ksr1 APN 11 79036725 missense probably damaging 1.00
IGL02823:Ksr1 APN 11 79021403 missense probably benign 0.35
IGL02879:Ksr1 APN 11 79074444 missense probably damaging 1.00
julius UTSW 11 79036494 critical splice donor site probably null
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0364:Ksr1 UTSW 11 79029025 splice site probably benign
R0479:Ksr1 UTSW 11 79025283 missense probably damaging 1.00
R0590:Ksr1 UTSW 11 79045140 missense probably damaging 1.00
R0711:Ksr1 UTSW 11 79038247 splice site probably benign
R0743:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R0884:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R1272:Ksr1 UTSW 11 79146078 nonsense probably null
R1739:Ksr1 UTSW 11 79047305 missense probably damaging 1.00
R1885:Ksr1 UTSW 11 79020378 missense probably null
R1885:Ksr1 UTSW 11 79036521 missense probably damaging 1.00
R1886:Ksr1 UTSW 11 79020378 missense probably null
R2118:Ksr1 UTSW 11 79045193 missense probably benign 0.10
R2127:Ksr1 UTSW 11 79033313 missense probably damaging 1.00
R2939:Ksr1 UTSW 11 79045181 unclassified probably null
R4090:Ksr1 UTSW 11 79027477 missense probably damaging 1.00
R4675:Ksr1 UTSW 11 79074360 missense possibly damaging 0.81
R4854:Ksr1 UTSW 11 79027702 missense probably damaging 1.00
R5267:Ksr1 UTSW 11 79020425 missense probably damaging 1.00
R5813:Ksr1 UTSW 11 79038198 missense probably damaging 1.00
R5928:Ksr1 UTSW 11 79059719 missense probably damaging 0.96
R6199:Ksr1 UTSW 11 79020441 missense possibly damaging 0.65
R6346:Ksr1 UTSW 11 79019664 missense possibly damaging 0.93
R6885:Ksr1 UTSW 11 79047295 critical splice donor site probably null
R7016:Ksr1 UTSW 11 79027536 missense probably damaging 1.00
U24488:Ksr1 UTSW 11 79047441 missense probably damaging 1.00
Z1088:Ksr1 UTSW 11 79044879 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTCCATACCACCCATGCGTG -3'
(R):5'- AGTGCACAAAGGAAGCTCCC -3'

Sequencing Primer
(F):5'- TGCGTGCATGAGTCTCGGAC -3'
(R):5'- AAAGGAAGCTCCCGCCTG -3'
Posted On2018-05-04