Incidental Mutation 'R6377:Loxhd1'
ID515086
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6377 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77380432 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 925 (D925E)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]
Predicted Effect probably damaging
Transcript: ENSMUST00000035501
AA Change: D902E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818
AA Change: D902E

DomainStartEndE-ValueType
Pfam:PLAT 1 53 3.2e-7 PFAM
LH2 63 176 1.1e-4 SMART
LH2 192 306 4.02e-4 SMART
LH2 320 442 3.79e-6 SMART
LH2 451 567 5.92e-6 SMART
LH2 581 696 7.67e-3 SMART
LH2 793 913 1.47e-11 SMART
low complexity region 922 931 N/A INTRINSIC
SCOP:d1lox_2 949 974 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096547
AA Change: D925E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: D925E

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123410
AA Change: D59E

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: D59E

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148341
AA Change: D816E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: D816E

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Cyp4a14 A G 4: 115,496,083 Y11H probably benign Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Igf1r A T 7: 68,201,250 Y931F probably benign Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Kif5b A T 18: 6,212,562 L754Q probably damaging Het
Ksr1 C T 11: 79,036,494 probably null Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Mtbp A G 15: 55,557,620 M1V probably null Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Pot1a A G 6: 25,778,870 V75A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 synonymous probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7967:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R8042:Loxhd1 UTSW 18 77431192 missense not run
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGACTGGGAGTGTCTCTG -3'
(R):5'- GCAGCTACAGTATCGAGGAG -3'

Sequencing Primer
(F):5'- TTTTTAGACCAGGCAGAATGGG -3'
(R):5'- TGCCCAGAGCCCATAAGTG -3'
Posted On2018-05-04