Mutagenetix > Incidental Mutations

Incidental Mutation 'R6378:Dpp10'

515091

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6378 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 123411739 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 353 (C353F)

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

Predicted Effect

probably damaging
Transcript: ENSMUST00000112603
AA Change: C342F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: C342F

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112606
AA Change: C353F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: C353F

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Meta Mutation Damage Score

0.8801

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago2	A	T	15: 73,123,925	D408E	probably benign	Het
Agpat2	T	C	2: 26,596,135	N178S	probably benign	Het
Arsi	T	C	18: 60,916,501	F152S	probably damaging	Het
Atp13a2	T	A	4: 141,007,056	L1163Q	probably benign	Het
Bpifb2	T	A	2: 153,891,152	L385Q	possibly damaging	Het
C330018D20Rik	A	G	18: 56,962,507	L2P	probably damaging	Het
Cby3	A	G	11: 50,359,533	T189A	probably damaging	Het
Cdc42bpa	A	T	1: 180,093,996	D567V	possibly damaging	Het
Cdh5	T	A	8: 104,126,536		probably null	Het
Cela1	C	T	15: 100,687,190	V20I	probably benign	Het
Cmpk2	G	A	12: 26,469,416	G22E	possibly damaging	Het
Ctcf	T	A	8: 105,663,791	V10E	possibly damaging	Het
Efcab3	A	G	11: 105,108,794	S5546G	possibly damaging	Het
Elp3	G	T	14: 65,592,971	Y10*	probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Eml4	T	A	17: 83,448,217	W336R	probably damaging	Het
Erich6	T	C	3: 58,622,359		probably null	Het
Eya1	T	C	1: 14,302,803	N31D	possibly damaging	Het
Fam103a1	A	G	7: 81,767,639	Y29C	probably damaging	Het
Fam81a	T	A	9: 70,110,346	N106Y	probably damaging	Het
Frrs1	A	G	3: 116,900,990	T487A	possibly damaging	Het
Ganc	T	C	2: 120,433,826	M420T	probably damaging	Het
Gimap7	A	T	6: 48,724,182	E234V	probably damaging	Het
Gpbp1	T	C	13: 111,433,612	N400S	probably damaging	Het
Gucy2g	T	C	19: 55,240,945	S98G	probably benign	Het
Hoxd10	T	C	2: 74,694,334	I330T	possibly damaging	Het
Ik	T	A	18: 36,757,288	I539N	probably damaging	Het
Il17rb	G	A	14: 30,000,363	T237I	probably damaging	Het
Ing2	T	A	8: 47,669,258	Q85L	probably benign	Het
Lrp4	C	A	2: 91,493,829	N1208K	probably benign	Het
Lvrn	T	A	18: 46,894,957	S888R	probably benign	Het
Map2	T	C	1: 66,415,329	V1126A	probably damaging	Het
Mapkapk5	A	G	5: 121,539,170		probably null	Het
Mis18bp1	T	C	12: 65,149,247	D581G	probably benign	Het
Muc4	T	C	16: 32,778,946	V3289A	probably benign	Het
Myom2	T	A	8: 15,099,356	I609N	probably benign	Het
Nav1	A	T	1: 135,454,695	M1343K	probably damaging	Het
Ndufaf1	T	C	2: 119,655,726	I302V	probably damaging	Het
Neb	T	A	2: 52,293,721	K978N	probably damaging	Het
Nol8	A	G	13: 49,667,355	E878G	probably damaging	Het
Nrde2	A	T	12: 100,130,757	I928N	probably damaging	Het
Nxf1	T	A	19: 8,764,546	D145E	probably benign	Het
Obox3	T	A	7: 15,626,102	H214L	probably benign	Het
Obscn	T	C	11: 59,073,746	E3199G	probably damaging	Het
Ogfod3	T	C	11: 121,202,935	E83G	probably benign	Het
Olfr1416	A	G	1: 92,480,456	L55P	probably damaging	Het
Olfr281	T	C	15: 98,456,544	V78A	probably benign	Het
Olfr457	T	G	6: 42,471,753	M142L	probably benign	Het
Olfr96	T	A	17: 37,225,797	V224E	probably benign	Het
Pcsk4	G	T	10: 80,328,975	H69N	probably benign	Het
Plcl2	C	T	17: 50,668,160		probably null	Het
Pmfbp1	T	C	8: 109,530,266	I534T	probably damaging	Het
Pqlc3	T	C	12: 16,997,643	Y96C	probably damaging	Het
Prss23	A	T	7: 89,510,033	I276N	probably damaging	Het
Rhd	T	A	4: 134,894,385	F403Y	possibly damaging	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Scg5	A	G	2: 113,827,392	V58A	possibly damaging	Het
Scn5a	C	T	9: 119,486,036	G1868R	probably damaging	Het
Secisbp2l	A	G	2: 125,768,325	S225P	possibly damaging	Het
Sema4f	A	T	6: 82,917,632	L486*	probably null	Het
Slc25a47	G	A	12: 108,856,143	R286H	probably damaging	Het
Slc5a8	A	C	10: 88,905,054	K277T	probably damaging	Het
Sorcs1	T	A	19: 50,225,177	E704V	possibly damaging	Het
Sptan1	T	C	2: 30,018,515	S1768P	probably damaging	Het
Srd5a2	C	T	17: 74,021,383		probably null	Het
Sytl2	A	T	7: 90,358,224	K65*	probably null	Het
Tas2r109	T	G	6: 132,980,881	I29L	probably benign	Het
Tfap2a	A	T	13: 40,723,241	V234E	possibly damaging	Het
Tgfbr3	G	A	5: 107,177,813	L128F	probably benign	Het
Trappc12	A	T	12: 28,747,083	L150Q	probably damaging	Het
Trim43b	T	A	9: 89,085,399	I395L	probably benign	Het
U2surp	C	T	9: 95,491,421	E232K	probably benign	Het
Vax1	T	C	19: 59,166,224	N327S	probably benign	Het
Vmn1r14	T	C	6: 57,233,602	V11A	probably benign	Het
Vmn1r60	A	G	7: 5,544,783	V106A	probably damaging	Het
Vmn2r106	T	C	17: 20,278,405	S415G	probably benign	Het
Vmn2r3	C	T	3: 64,275,096	G394D	probably damaging	Het
Ybx2	A	G	11: 69,940,353	E63G	possibly damaging	Het
Zfhx4	T	A	3: 5,243,350	N545K	probably benign	Het
Zp1	T	C	19: 10,914,853	T56A	probably benign	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2079:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R2974:Dpp10	UTSW	1	123411705	splice site	probably benign
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6429:Dpp10	UTSW	1	123367601	missense	possibly damaging	0.72
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R6951:Dpp10	UTSW	1	123341650	missense	possibly damaging	0.93
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7297:Dpp10	UTSW	1	123353428	nonsense	probably null
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8067:Dpp10	UTSW	1	123352660	missense	probably benign
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTCCTCAGTCAGAAAGTGTACAC -3'
(R):5'- GAAAAGTCAAGTGTAGGCTAGTTTC -3'

Sequencing Primer
(F):5'- CTCAGTCAGAAAGTGTACACATTAAC -3'
(R):5'- TTGCATCTAAAACAACACATGATTC -3'

Posted On

2018-05-04