Mutagenetix > Incidental Mutations

Incidental Mutation 'R6378:Ganc'

515101

Institutional Source

Beutler Lab

Gene Symbol

Ganc

Ensembl Gene

ENSMUSG00000062646

Gene Name

glucosidase, alpha; neutral C

Synonyms

5830445O15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.673) question?

Stock #

R6378 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120403896-120461700 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120433826 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 420 (M420T)

Ref Sequence

ENSEMBL: ENSMUSP00000116898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000135074]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000043755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132835

Predicted Effect

probably damaging
Transcript: ENSMUST00000135074
AA Change: M420T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: M420T

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	221	292	2.3e-21	PFAM
Pfam:Glyco_hydro_31	333	778	2.5e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145134

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152437

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago2	A	T	15: 73,123,925	D408E	probably benign	Het
Agpat2	T	C	2: 26,596,135	N178S	probably benign	Het
Arsi	T	C	18: 60,916,501	F152S	probably damaging	Het
Atp13a2	T	A	4: 141,007,056	L1163Q	probably benign	Het
Bpifb2	T	A	2: 153,891,152	L385Q	possibly damaging	Het
C330018D20Rik	A	G	18: 56,962,507	L2P	probably damaging	Het
Cby3	A	G	11: 50,359,533	T189A	probably damaging	Het
Cdc42bpa	A	T	1: 180,093,996	D567V	possibly damaging	Het
Cdh5	T	A	8: 104,126,536		probably null	Het
Cela1	C	T	15: 100,687,190	V20I	probably benign	Het
Cmpk2	G	A	12: 26,469,416	G22E	possibly damaging	Het
Ctcf	T	A	8: 105,663,791	V10E	possibly damaging	Het
Dpp10	C	A	1: 123,411,739	C353F	probably damaging	Het
Efcab3	A	G	11: 105,108,794	S5546G	possibly damaging	Het
Elp3	G	T	14: 65,592,971	Y10*	probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Eml4	T	A	17: 83,448,217	W336R	probably damaging	Het
Erich6	T	C	3: 58,622,359		probably null	Het
Eya1	T	C	1: 14,302,803	N31D	possibly damaging	Het
Fam103a1	A	G	7: 81,767,639	Y29C	probably damaging	Het
Fam81a	T	A	9: 70,110,346	N106Y	probably damaging	Het
Frrs1	A	G	3: 116,900,990	T487A	possibly damaging	Het
Gimap7	A	T	6: 48,724,182	E234V	probably damaging	Het
Gpbp1	T	C	13: 111,433,612	N400S	probably damaging	Het
Gucy2g	T	C	19: 55,240,945	S98G	probably benign	Het
Hoxd10	T	C	2: 74,694,334	I330T	possibly damaging	Het
Ik	T	A	18: 36,757,288	I539N	probably damaging	Het
Il17rb	G	A	14: 30,000,363	T237I	probably damaging	Het
Ing2	T	A	8: 47,669,258	Q85L	probably benign	Het
Lrp4	C	A	2: 91,493,829	N1208K	probably benign	Het
Lvrn	T	A	18: 46,894,957	S888R	probably benign	Het
Map2	T	C	1: 66,415,329	V1126A	probably damaging	Het
Mapkapk5	A	G	5: 121,539,170		probably null	Het
Mis18bp1	T	C	12: 65,149,247	D581G	probably benign	Het
Muc4	T	C	16: 32,778,946	V3289A	probably benign	Het
Myom2	T	A	8: 15,099,356	I609N	probably benign	Het
Nav1	A	T	1: 135,454,695	M1343K	probably damaging	Het
Ndufaf1	T	C	2: 119,655,726	I302V	probably damaging	Het
Neb	T	A	2: 52,293,721	K978N	probably damaging	Het
Nol8	A	G	13: 49,667,355	E878G	probably damaging	Het
Nrde2	A	T	12: 100,130,757	I928N	probably damaging	Het
Nxf1	T	A	19: 8,764,546	D145E	probably benign	Het
Obox3	T	A	7: 15,626,102	H214L	probably benign	Het
Obscn	T	C	11: 59,073,746	E3199G	probably damaging	Het
Ogfod3	T	C	11: 121,202,935	E83G	probably benign	Het
Olfr1416	A	G	1: 92,480,456	L55P	probably damaging	Het
Olfr281	T	C	15: 98,456,544	V78A	probably benign	Het
Olfr457	T	G	6: 42,471,753	M142L	probably benign	Het
Olfr96	T	A	17: 37,225,797	V224E	probably benign	Het
Pcsk4	G	T	10: 80,328,975	H69N	probably benign	Het
Plcl2	C	T	17: 50,668,160		probably null	Het
Pmfbp1	T	C	8: 109,530,266	I534T	probably damaging	Het
Pqlc3	T	C	12: 16,997,643	Y96C	probably damaging	Het
Prss23	A	T	7: 89,510,033	I276N	probably damaging	Het
Rhd	T	A	4: 134,894,385	F403Y	possibly damaging	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Scg5	A	G	2: 113,827,392	V58A	possibly damaging	Het
Scn5a	C	T	9: 119,486,036	G1868R	probably damaging	Het
Secisbp2l	A	G	2: 125,768,325	S225P	possibly damaging	Het
Sema4f	A	T	6: 82,917,632	L486*	probably null	Het
Slc25a47	G	A	12: 108,856,143	R286H	probably damaging	Het
Slc5a8	A	C	10: 88,905,054	K277T	probably damaging	Het
Sorcs1	T	A	19: 50,225,177	E704V	possibly damaging	Het
Sptan1	T	C	2: 30,018,515	S1768P	probably damaging	Het
Srd5a2	C	T	17: 74,021,383		probably null	Het
Sytl2	A	T	7: 90,358,224	K65*	probably null	Het
Tas2r109	T	G	6: 132,980,881	I29L	probably benign	Het
Tfap2a	A	T	13: 40,723,241	V234E	possibly damaging	Het
Tgfbr3	G	A	5: 107,177,813	L128F	probably benign	Het
Trappc12	A	T	12: 28,747,083	L150Q	probably damaging	Het
Trim43b	T	A	9: 89,085,399	I395L	probably benign	Het
U2surp	C	T	9: 95,491,421	E232K	probably benign	Het
Vax1	T	C	19: 59,166,224	N327S	probably benign	Het
Vmn1r14	T	C	6: 57,233,602	V11A	probably benign	Het
Vmn1r60	A	G	7: 5,544,783	V106A	probably damaging	Het
Vmn2r106	T	C	17: 20,278,405	S415G	probably benign	Het
Vmn2r3	C	T	3: 64,275,096	G394D	probably damaging	Het
Ybx2	A	G	11: 69,940,353	E63G	possibly damaging	Het
Zfhx4	T	A	3: 5,243,350	N545K	probably benign	Het
Zp1	T	C	19: 10,914,853	T56A	probably benign	Het

Other mutations in Ganc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Ganc	APN	2	120441598	missense	probably damaging	1.00
IGL00913:Ganc	APN	2	120439452	splice site	probably benign
IGL01077:Ganc	APN	2	120446515	missense	possibly damaging	0.50
IGL01773:Ganc	APN	2	120459884	missense	possibly damaging	0.87
IGL01812:Ganc	APN	2	120411526	missense	probably benign	0.00
IGL02029:Ganc	APN	2	120459857	missense	probably benign	0.00
IGL02067:Ganc	APN	2	120406304	missense	probably benign	0.16
IGL02290:Ganc	APN	2	120448423	missense	possibly damaging	0.90
IGL02355:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02362:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02553:Ganc	APN	2	120458134	missense	probably benign
IGL02808:Ganc	APN	2	120411511	missense	probably benign	0.00
IGL02966:Ganc	APN	2	120433648	missense	probably damaging	1.00
IGL03356:Ganc	APN	2	120435288	missense	probably benign	0.22
IGL03405:Ganc	APN	2	120433766	missense	probably damaging	1.00
ingenuous	UTSW	2	120444149	missense	probably damaging	1.00
R0464:Ganc	UTSW	2	120436694	missense	probably benign	0.07
R0511:Ganc	UTSW	2	120448401	nonsense	probably null
R0932:Ganc	UTSW	2	120458129	missense	probably damaging	0.99
R1467:Ganc	UTSW	2	120430928	splice site	probably benign
R1902:Ganc	UTSW	2	120446482	missense	probably damaging	1.00
R2087:Ganc	UTSW	2	120457257	missense	probably damaging	1.00
R4668:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4669:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4725:Ganc	UTSW	2	120435273	missense	probably damaging	0.99
R4735:Ganc	UTSW	2	120436623	splice site	silent
R4738:Ganc	UTSW	2	120452594	missense	probably damaging	0.97
R4839:Ganc	UTSW	2	120459823	missense	probably benign
R4951:Ganc	UTSW	2	120456047	missense	probably benign	0.00
R5841:Ganc	UTSW	2	120411539	missense	possibly damaging	0.65
R5997:Ganc	UTSW	2	120430605	missense	possibly damaging	0.55
R6142:Ganc	UTSW	2	120430737	critical splice donor site	probably null
R6711:Ganc	UTSW	2	120450839	missense	possibly damaging	0.74
R6777:Ganc	UTSW	2	120444149	missense	probably damaging	1.00
R7229:Ganc	UTSW	2	120427775	missense	possibly damaging	0.92
R7235:Ganc	UTSW	2	120433717	missense	probably damaging	1.00
R7241:Ganc	UTSW	2	120441529	missense	probably damaging	1.00
R7326:Ganc	UTSW	2	120430599	missense	probably damaging	1.00
R7567:Ganc	UTSW	2	120456101	missense	probably benign	0.01
R7685:Ganc	UTSW	2	120433792	missense	probably damaging	1.00
R7736:Ganc	UTSW	2	120433814	missense	possibly damaging	0.83
R7784:Ganc	UTSW	2	120436668	nonsense	probably null
R7955:Ganc	UTSW	2	120430700	missense	probably damaging	1.00
R8222:Ganc	UTSW	2	120446452	missense	probably damaging	1.00
R8247:Ganc	UTSW	2	120436700	missense	probably null	0.52
R8306:Ganc	UTSW	2	120422079	missense	probably benign	0.02
X0027:Ganc	UTSW	2	120448450	missense	probably damaging	1.00
Z1177:Ganc	UTSW	2	120433794	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCTCTTTTAGGCACACAAGC -3'
(R):5'- GCATCTTGAACATGGAAAGGTC -3'

Sequencing Primer
(F):5'- GCACACAAGCCATGCCC -3'
(R):5'- CTGGCTGCTCTTAAAGAAACCTGG -3'

Posted On

2018-05-04