Mutagenetix > Incidental Mutations

Incidental Mutation 'R6378:Scn5a'

515132

Institutional Source

Beutler Lab

Gene Symbol

Scn5a

Ensembl Gene

ENSMUSG00000032511

Gene Name

sodium channel, voltage-gated, type V, alpha

Synonyms

Nav1.5c, Nav1.5, mH1, SkM2

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6378 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119483408-119579016 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119486036 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1868 (G1868R)

Ref Sequence

ENSEMBL: ENSMUSP00000113272 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065196
AA Change: G1869R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: G1869R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	130	423	2.4e-82	PFAM
Pfam:Na_trans_cytopl	478	667	5.2e-49	PFAM
Pfam:Ion_trans	716	950	1.1e-54	PFAM
Pfam:Na_trans_assoc	955	1203	2.9e-57	PFAM
Pfam:Ion_trans	1207	1484	2e-66	PFAM
Pfam:Ion_trans	1530	1786	7.2e-55	PFAM
Pfam:PKD_channel	1627	1780	3.5e-7	PFAM
IQ	1903	1925	5e-2	SMART
low complexity region	1961	1983	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117911
AA Change: G1869R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: G1869R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	159	412	9.6e-76	PFAM
coiled coil region	413	451	N/A	INTRINSIC
Pfam:DUF3451	461	668	4.9e-44	PFAM
Pfam:Ion_trans	751	940	2.3e-46	PFAM
Pfam:Na_trans_assoc	955	1218	1.2e-73	PFAM
Pfam:Ion_trans	1244	1472	2e-56	PFAM
PDB:1BYY\|A	1474	1526	5e-29	PDB
Pfam:Ion_trans	1565	1774	1.5e-49	PFAM
Pfam:PKD_channel	1627	1781	2.6e-10	PFAM
IQ	1903	1925	5e-2	SMART
low complexity region	1961	1983	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120420
AA Change: G1868R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: G1868R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	159	412	4.5e-75	PFAM
coiled coil region	413	451	N/A	INTRINSIC
Pfam:DUF3451	461	668	7.4e-43	PFAM
Pfam:Ion_trans	751	940	1.2e-45	PFAM
Pfam:Na_trans_assoc	955	1217	1.6e-72	PFAM
Pfam:Ion_trans	1243	1471	1.1e-55	PFAM
PDB:1BYY\|A	1473	1525	5e-29	PDB
Pfam:Ion_trans	1564	1773	8.2e-49	PFAM
Pfam:PKD_channel	1626	1780	2.6e-9	PFAM
IQ	1902	1924	5e-2	SMART
low complexity region	1960	1982	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago2	A	T	15: 73,123,925	D408E	probably benign	Het
Agpat2	T	C	2: 26,596,135	N178S	probably benign	Het
Arsi	T	C	18: 60,916,501	F152S	probably damaging	Het
Atp13a2	T	A	4: 141,007,056	L1163Q	probably benign	Het
Bpifb2	T	A	2: 153,891,152	L385Q	possibly damaging	Het
C330018D20Rik	A	G	18: 56,962,507	L2P	probably damaging	Het
Cby3	A	G	11: 50,359,533	T189A	probably damaging	Het
Cdc42bpa	A	T	1: 180,093,996	D567V	possibly damaging	Het
Cdh5	T	A	8: 104,126,536		probably null	Het
Cela1	C	T	15: 100,687,190	V20I	probably benign	Het
Cmpk2	G	A	12: 26,469,416	G22E	possibly damaging	Het
Ctcf	T	A	8: 105,663,791	V10E	possibly damaging	Het
Dpp10	C	A	1: 123,411,739	C353F	probably damaging	Het
Efcab3	A	G	11: 105,108,794	S5546G	possibly damaging	Het
Elp3	G	T	14: 65,592,971	Y10*	probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Eml4	T	A	17: 83,448,217	W336R	probably damaging	Het
Erich6	T	C	3: 58,622,359		probably null	Het
Eya1	T	C	1: 14,302,803	N31D	possibly damaging	Het
Fam103a1	A	G	7: 81,767,639	Y29C	probably damaging	Het
Fam81a	T	A	9: 70,110,346	N106Y	probably damaging	Het
Frrs1	A	G	3: 116,900,990	T487A	possibly damaging	Het
Ganc	T	C	2: 120,433,826	M420T	probably damaging	Het
Gimap7	A	T	6: 48,724,182	E234V	probably damaging	Het
Gpbp1	T	C	13: 111,433,612	N400S	probably damaging	Het
Gucy2g	T	C	19: 55,240,945	S98G	probably benign	Het
Hoxd10	T	C	2: 74,694,334	I330T	possibly damaging	Het
Ik	T	A	18: 36,757,288	I539N	probably damaging	Het
Il17rb	G	A	14: 30,000,363	T237I	probably damaging	Het
Ing2	T	A	8: 47,669,258	Q85L	probably benign	Het
Lrp4	C	A	2: 91,493,829	N1208K	probably benign	Het
Lvrn	T	A	18: 46,894,957	S888R	probably benign	Het
Map2	T	C	1: 66,415,329	V1126A	probably damaging	Het
Mapkapk5	A	G	5: 121,539,170		probably null	Het
Mis18bp1	T	C	12: 65,149,247	D581G	probably benign	Het
Muc4	T	C	16: 32,778,946	V3289A	probably benign	Het
Myom2	T	A	8: 15,099,356	I609N	probably benign	Het
Nav1	A	T	1: 135,454,695	M1343K	probably damaging	Het
Ndufaf1	T	C	2: 119,655,726	I302V	probably damaging	Het
Neb	T	A	2: 52,293,721	K978N	probably damaging	Het
Nol8	A	G	13: 49,667,355	E878G	probably damaging	Het
Nrde2	A	T	12: 100,130,757	I928N	probably damaging	Het
Nxf1	T	A	19: 8,764,546	D145E	probably benign	Het
Obox3	T	A	7: 15,626,102	H214L	probably benign	Het
Obscn	T	C	11: 59,073,746	E3199G	probably damaging	Het
Ogfod3	T	C	11: 121,202,935	E83G	probably benign	Het
Olfr1416	A	G	1: 92,480,456	L55P	probably damaging	Het
Olfr281	T	C	15: 98,456,544	V78A	probably benign	Het
Olfr457	T	G	6: 42,471,753	M142L	probably benign	Het
Olfr96	T	A	17: 37,225,797	V224E	probably benign	Het
Pcsk4	G	T	10: 80,328,975	H69N	probably benign	Het
Plcl2	C	T	17: 50,668,160		probably null	Het
Pmfbp1	T	C	8: 109,530,266	I534T	probably damaging	Het
Pqlc3	T	C	12: 16,997,643	Y96C	probably damaging	Het
Prss23	A	T	7: 89,510,033	I276N	probably damaging	Het
Rhd	T	A	4: 134,894,385	F403Y	possibly damaging	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Scg5	A	G	2: 113,827,392	V58A	possibly damaging	Het
Secisbp2l	A	G	2: 125,768,325	S225P	possibly damaging	Het
Sema4f	A	T	6: 82,917,632	L486*	probably null	Het
Slc25a47	G	A	12: 108,856,143	R286H	probably damaging	Het
Slc5a8	A	C	10: 88,905,054	K277T	probably damaging	Het
Sorcs1	T	A	19: 50,225,177	E704V	possibly damaging	Het
Sptan1	T	C	2: 30,018,515	S1768P	probably damaging	Het
Srd5a2	C	T	17: 74,021,383		probably null	Het
Sytl2	A	T	7: 90,358,224	K65*	probably null	Het
Tas2r109	T	G	6: 132,980,881	I29L	probably benign	Het
Tfap2a	A	T	13: 40,723,241	V234E	possibly damaging	Het
Tgfbr3	G	A	5: 107,177,813	L128F	probably benign	Het
Trappc12	A	T	12: 28,747,083	L150Q	probably damaging	Het
Trim43b	T	A	9: 89,085,399	I395L	probably benign	Het
U2surp	C	T	9: 95,491,421	E232K	probably benign	Het
Vax1	T	C	19: 59,166,224	N327S	probably benign	Het
Vmn1r14	T	C	6: 57,233,602	V11A	probably benign	Het
Vmn1r60	A	G	7: 5,544,783	V106A	probably damaging	Het
Vmn2r106	T	C	17: 20,278,405	S415G	probably benign	Het
Vmn2r3	C	T	3: 64,275,096	G394D	probably damaging	Het
Ybx2	A	G	11: 69,940,353	E63G	possibly damaging	Het
Zfhx4	T	A	3: 5,243,350	N545K	probably benign	Het
Zp1	T	C	19: 10,914,853	T56A	probably benign	Het

Other mutations in Scn5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Scn5a	APN	9	119486224	missense	probably damaging	1.00
IGL00480:Scn5a	APN	9	119517538	missense	possibly damaging	0.73
IGL00542:Scn5a	APN	9	119492126	missense	probably damaging	1.00
IGL00852:Scn5a	APN	9	119537682	missense	probably benign	0.26
IGL00895:Scn5a	APN	9	119513104	splice site	probably null
IGL00905:Scn5a	APN	9	119536501	missense	probably damaging	1.00
IGL01347:Scn5a	APN	9	119562441	nonsense	probably null
IGL01396:Scn5a	APN	9	119534704	missense	probably damaging	0.98
IGL01402:Scn5a	APN	9	119486470	missense	probably damaging	1.00
IGL01404:Scn5a	APN	9	119486470	missense	probably damaging	1.00
IGL01487:Scn5a	APN	9	119562623	start codon destroyed	probably null	0.90
IGL01612:Scn5a	APN	9	119486025	missense	possibly damaging	0.86
IGL02134:Scn5a	APN	9	119485892	missense	probably damaging	0.98
IGL02434:Scn5a	APN	9	119533793	missense	possibly damaging	0.83
IGL02698:Scn5a	APN	9	119521097	missense	probably damaging	1.00
IGL02717:Scn5a	APN	9	119529010	missense	probably benign	0.12
IGL02746:Scn5a	APN	9	119550637	missense	probably damaging	1.00
IGL02951:Scn5a	APN	9	119495685	missense	probably damaging	1.00
IGL03155:Scn5a	APN	9	119512182	missense	possibly damaging	0.74
IGL03188:Scn5a	APN	9	119522566	missense	probably damaging	1.00
IGL03268:Scn5a	APN	9	119521231	missense	probably damaging	1.00
IGL03287:Scn5a	APN	9	119489778	missense	probably damaging	1.00
IGL03328:Scn5a	APN	9	119537636	missense	probably benign	0.12
PIT4142001:Scn5a	UTSW	9	119486258	missense	probably damaging	1.00
PIT4520001:Scn5a	UTSW	9	119534570	missense	possibly damaging	0.56
R0026:Scn5a	UTSW	9	119522566	missense	probably damaging	1.00
R0044:Scn5a	UTSW	9	119492047	critical splice donor site	probably null
R0044:Scn5a	UTSW	9	119492047	critical splice donor site	probably null
R0267:Scn5a	UTSW	9	119543135	missense	probably damaging	0.98
R0313:Scn5a	UTSW	9	119534571	missense	probably damaging	1.00
R0360:Scn5a	UTSW	9	119522599	missense	probably damaging	0.99
R0364:Scn5a	UTSW	9	119522599	missense	probably damaging	0.99
R0369:Scn5a	UTSW	9	119533772	missense	probably damaging	0.99
R0512:Scn5a	UTSW	9	119550658	missense	probably damaging	1.00
R0681:Scn5a	UTSW	9	119539640	missense	probably damaging	0.96
R1163:Scn5a	UTSW	9	119533927	missense	probably damaging	1.00
R1469:Scn5a	UTSW	9	119533661	critical splice donor site	probably null
R1469:Scn5a	UTSW	9	119533661	critical splice donor site	probably null
R1470:Scn5a	UTSW	9	119536475	missense	possibly damaging	0.82
R1470:Scn5a	UTSW	9	119536475	missense	possibly damaging	0.82
R1530:Scn5a	UTSW	9	119495562	missense	probably damaging	1.00
R1532:Scn5a	UTSW	9	119533847	missense	probably damaging	1.00
R1544:Scn5a	UTSW	9	119486633	missense	probably damaging	1.00
R1588:Scn5a	UTSW	9	119521301	missense	probably damaging	1.00
R1597:Scn5a	UTSW	9	119562497	missense	probably damaging	0.99
R1607:Scn5a	UTSW	9	119486092	missense	probably damaging	1.00
R1657:Scn5a	UTSW	9	119562380	missense	probably damaging	1.00
R1664:Scn5a	UTSW	9	119521177	missense	possibly damaging	0.84
R1785:Scn5a	UTSW	9	119521129	missense	probably damaging	1.00
R1925:Scn5a	UTSW	9	119529019	missense	probably benign
R1956:Scn5a	UTSW	9	119517413	missense	possibly damaging	0.82
R2006:Scn5a	UTSW	9	119536480	missense	probably damaging	1.00
R2061:Scn5a	UTSW	9	119485651	missense	probably damaging	0.98
R2083:Scn5a	UTSW	9	119492123	missense	probably benign	0.45
R2180:Scn5a	UTSW	9	119516051	missense	probably benign
R2216:Scn5a	UTSW	9	119485612	missense	probably benign	0.37
R2216:Scn5a	UTSW	9	119513085	missense	probably benign
R2320:Scn5a	UTSW	9	119529956	critical splice donor site	probably null
R2377:Scn5a	UTSW	9	119539727	missense	probably damaging	1.00
R2510:Scn5a	UTSW	9	119533685	missense	probably benign	0.05
R3113:Scn5a	UTSW	9	119485672	missense	probably damaging	1.00
R3769:Scn5a	UTSW	9	119552076	critical splice acceptor site	probably benign
R4133:Scn5a	UTSW	9	119486372	missense	probably damaging	1.00
R4164:Scn5a	UTSW	9	119495778	missense	probably damaging	1.00
R4447:Scn5a	UTSW	9	119550627	missense	probably damaging	1.00
R4635:Scn5a	UTSW	9	119528985	missense	possibly damaging	0.47
R4734:Scn5a	UTSW	9	119539538	missense	probably damaging	0.98
R4829:Scn5a	UTSW	9	119534707	missense	probably benign	0.00
R4867:Scn5a	UTSW	9	119550671	nonsense	probably null
R5055:Scn5a	UTSW	9	119522566	missense	probably damaging	1.00
R5229:Scn5a	UTSW	9	119535976	missense	probably damaging	1.00
R5344:Scn5a	UTSW	9	119534007	missense	probably benign	0.25
R5424:Scn5a	UTSW	9	119501734	missense	probably damaging	1.00
R5517:Scn5a	UTSW	9	119495713	missense	probably damaging	1.00
R5526:Scn5a	UTSW	9	119521171	missense	probably damaging	1.00
R5560:Scn5a	UTSW	9	119560286	missense	probably damaging	1.00
R5719:Scn5a	UTSW	9	119530052	missense	possibly damaging	0.91
R5726:Scn5a	UTSW	9	119533847	missense	probably damaging	1.00
R5800:Scn5a	UTSW	9	119501666	missense	probably damaging	1.00
R5826:Scn5a	UTSW	9	119521333	missense	probably damaging	1.00
R6046:Scn5a	UTSW	9	119562374	missense	probably damaging	1.00
R6101:Scn5a	UTSW	9	119522650	missense	probably damaging	0.98
R6162:Scn5a	UTSW	9	119522555	missense	probably damaging	0.98
R6375:Scn5a	UTSW	9	119543356	missense	probably damaging	1.00
R6464:Scn5a	UTSW	9	119534580	missense	probably damaging	1.00
R6794:Scn5a	UTSW	9	119535889	missense	probably damaging	0.98
R6799:Scn5a	UTSW	9	119495622	missense	possibly damaging	0.62
R6850:Scn5a	UTSW	9	119501749	missense	possibly damaging	0.92
R6858:Scn5a	UTSW	9	119492090	missense	probably benign	0.11
R6861:Scn5a	UTSW	9	119530023	missense	probably damaging	1.00
R6875:Scn5a	UTSW	9	119486644	missense	probably damaging	1.00
R6989:Scn5a	UTSW	9	119486329	missense	probably damaging	1.00
R7009:Scn5a	UTSW	9	119485930	missense	probably damaging	1.00
R7064:Scn5a	UTSW	9	119489911	missense	probably damaging	0.99
R7145:Scn5a	UTSW	9	119486371	missense	probably damaging	1.00
R7212:Scn5a	UTSW	9	119543385	missense	possibly damaging	0.94
R7238:Scn5a	UTSW	9	119491544	missense	possibly damaging	0.73
R7266:Scn5a	UTSW	9	119562560	missense	probably benign	0.37
R7348:Scn5a	UTSW	9	119535833	missense	probably benign	0.00
R7399:Scn5a	UTSW	9	119486530	missense	probably damaging	1.00
R7453:Scn5a	UTSW	9	119522590	missense	possibly damaging	0.82
R7495:Scn5a	UTSW	9	119543134	missense	probably damaging	0.99
R7681:Scn5a	UTSW	9	119529977	missense	probably benign	0.01
R7729:Scn5a	UTSW	9	119495540	missense	probably damaging	1.00
R7791:Scn5a	UTSW	9	119543336	missense	possibly damaging	0.47
R7794:Scn5a	UTSW	9	119529087	missense	probably damaging	0.99
R7873:Scn5a	UTSW	9	119498127	missense	probably damaging	1.00
R7951:Scn5a	UTSW	9	119529079	missense	probably damaging	1.00
R8154:Scn5a	UTSW	9	119562545	missense	possibly damaging	0.48
R8306:Scn5a	UTSW	9	119521291	missense	probably damaging	1.00
R8329:Scn5a	UTSW	9	119535964	missense	probably damaging	0.96
R8390:Scn5a	UTSW	9	119539538	missense	possibly damaging	0.59
R8536:Scn5a	UTSW	9	119539745	missense	probably damaging	1.00
X0023:Scn5a	UTSW	9	119517769	missense	probably damaging	1.00
X0065:Scn5a	UTSW	9	119485669	missense	probably damaging	1.00
Z1177:Scn5a	UTSW	9	119522518	missense	probably damaging	1.00
Z1177:Scn5a	UTSW	9	119533931	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GTAGGCAATGAGTCCCTCTC -3'
(R):5'- AGTATTTGGCCCTGTCCGAC -3'

Sequencing Primer
(F):5'- TCATCAGAGAGGCCACTGCTG -3'
(R):5'- GTCCGACTTTGCCGATGC -3'

Posted On

2018-05-04