Incidental Mutation 'R6378:Slc25a47'
ID515145
Institutional Source Beutler Lab
Gene Symbol Slc25a47
Ensembl Gene ENSMUSG00000048856
Gene Namesolute carrier family 25, member 47
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6378 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location108836046-108856815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108856143 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 286 (R286H)
Ref Sequence ENSEMBL: ENSMUSP00000050329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057026] [ENSMUST00000109848] [ENSMUST00000160477] [ENSMUST00000161154] [ENSMUST00000161410] [ENSMUST00000221080]
Predicted Effect probably damaging
Transcript: ENSMUST00000057026
AA Change: R286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050329
Gene: ENSMUSG00000048856
AA Change: R286H

DomainStartEndE-ValueType
Pfam:Mito_carr 1 84 1.2e-19 PFAM
Pfam:Mito_carr 94 212 1.5e-19 PFAM
Pfam:Mito_carr 215 308 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109848
SMART Domains Protein: ENSMUSP00000105474
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160477
Predicted Effect probably benign
Transcript: ENSMUST00000161154
SMART Domains Protein: ENSMUSP00000124625
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 446 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161410
SMART Domains Protein: ENSMUSP00000125320
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223296
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,123,925 D408E probably benign Het
Agpat2 T C 2: 26,596,135 N178S probably benign Het
Arsi T C 18: 60,916,501 F152S probably damaging Het
Atp13a2 T A 4: 141,007,056 L1163Q probably benign Het
Bpifb2 T A 2: 153,891,152 L385Q possibly damaging Het
C330018D20Rik A G 18: 56,962,507 L2P probably damaging Het
Cby3 A G 11: 50,359,533 T189A probably damaging Het
Cdc42bpa A T 1: 180,093,996 D567V possibly damaging Het
Cdh5 T A 8: 104,126,536 probably null Het
Cela1 C T 15: 100,687,190 V20I probably benign Het
Cmpk2 G A 12: 26,469,416 G22E possibly damaging Het
Ctcf T A 8: 105,663,791 V10E possibly damaging Het
Dpp10 C A 1: 123,411,739 C353F probably damaging Het
Efcab3 A G 11: 105,108,794 S5546G possibly damaging Het
Elp3 G T 14: 65,592,971 Y10* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eml4 T A 17: 83,448,217 W336R probably damaging Het
Erich6 T C 3: 58,622,359 probably null Het
Eya1 T C 1: 14,302,803 N31D possibly damaging Het
Fam103a1 A G 7: 81,767,639 Y29C probably damaging Het
Fam81a T A 9: 70,110,346 N106Y probably damaging Het
Frrs1 A G 3: 116,900,990 T487A possibly damaging Het
Ganc T C 2: 120,433,826 M420T probably damaging Het
Gimap7 A T 6: 48,724,182 E234V probably damaging Het
Gpbp1 T C 13: 111,433,612 N400S probably damaging Het
Gucy2g T C 19: 55,240,945 S98G probably benign Het
Hoxd10 T C 2: 74,694,334 I330T possibly damaging Het
Ik T A 18: 36,757,288 I539N probably damaging Het
Il17rb G A 14: 30,000,363 T237I probably damaging Het
Ing2 T A 8: 47,669,258 Q85L probably benign Het
Lrp4 C A 2: 91,493,829 N1208K probably benign Het
Lvrn T A 18: 46,894,957 S888R probably benign Het
Map2 T C 1: 66,415,329 V1126A probably damaging Het
Mapkapk5 A G 5: 121,539,170 probably null Het
Mis18bp1 T C 12: 65,149,247 D581G probably benign Het
Muc4 T C 16: 32,778,946 V3289A probably benign Het
Myom2 T A 8: 15,099,356 I609N probably benign Het
Nav1 A T 1: 135,454,695 M1343K probably damaging Het
Ndufaf1 T C 2: 119,655,726 I302V probably damaging Het
Neb T A 2: 52,293,721 K978N probably damaging Het
Nol8 A G 13: 49,667,355 E878G probably damaging Het
Nrde2 A T 12: 100,130,757 I928N probably damaging Het
Nxf1 T A 19: 8,764,546 D145E probably benign Het
Obox3 T A 7: 15,626,102 H214L probably benign Het
Obscn T C 11: 59,073,746 E3199G probably damaging Het
Ogfod3 T C 11: 121,202,935 E83G probably benign Het
Olfr1416 A G 1: 92,480,456 L55P probably damaging Het
Olfr281 T C 15: 98,456,544 V78A probably benign Het
Olfr457 T G 6: 42,471,753 M142L probably benign Het
Olfr96 T A 17: 37,225,797 V224E probably benign Het
Pcsk4 G T 10: 80,328,975 H69N probably benign Het
Plcl2 C T 17: 50,668,160 probably null Het
Pmfbp1 T C 8: 109,530,266 I534T probably damaging Het
Pqlc3 T C 12: 16,997,643 Y96C probably damaging Het
Prss23 A T 7: 89,510,033 I276N probably damaging Het
Rhd T A 4: 134,894,385 F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Scg5 A G 2: 113,827,392 V58A possibly damaging Het
Scn5a C T 9: 119,486,036 G1868R probably damaging Het
Secisbp2l A G 2: 125,768,325 S225P possibly damaging Het
Sema4f A T 6: 82,917,632 L486* probably null Het
Slc5a8 A C 10: 88,905,054 K277T probably damaging Het
Sorcs1 T A 19: 50,225,177 E704V possibly damaging Het
Sptan1 T C 2: 30,018,515 S1768P probably damaging Het
Srd5a2 C T 17: 74,021,383 probably null Het
Sytl2 A T 7: 90,358,224 K65* probably null Het
Tas2r109 T G 6: 132,980,881 I29L probably benign Het
Tfap2a A T 13: 40,723,241 V234E possibly damaging Het
Tgfbr3 G A 5: 107,177,813 L128F probably benign Het
Trappc12 A T 12: 28,747,083 L150Q probably damaging Het
Trim43b T A 9: 89,085,399 I395L probably benign Het
U2surp C T 9: 95,491,421 E232K probably benign Het
Vax1 T C 19: 59,166,224 N327S probably benign Het
Vmn1r14 T C 6: 57,233,602 V11A probably benign Het
Vmn1r60 A G 7: 5,544,783 V106A probably damaging Het
Vmn2r106 T C 17: 20,278,405 S415G probably benign Het
Vmn2r3 C T 3: 64,275,096 G394D probably damaging Het
Ybx2 A G 11: 69,940,353 E63G possibly damaging Het
Zfhx4 T A 3: 5,243,350 N545K probably benign Het
Zp1 T C 19: 10,914,853 T56A probably benign Het
Other mutations in Slc25a47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc25a47 APN 12 108855388 missense probably benign 0.00
IGL01138:Slc25a47 APN 12 108856022 missense probably damaging 1.00
IGL01545:Slc25a47 APN 12 108854216 missense probably benign 0.06
IGL01978:Slc25a47 APN 12 108851190 missense probably damaging 0.96
R0592:Slc25a47 UTSW 12 108854258 missense probably damaging 0.98
R4783:Slc25a47 UTSW 12 108855334 missense probably damaging 1.00
R5549:Slc25a47 UTSW 12 108856217 makesense probably null
R6085:Slc25a47 UTSW 12 108854328 missense probably benign 0.19
R6612:Slc25a47 UTSW 12 108855978 missense probably benign 0.02
R7237:Slc25a47 UTSW 12 108855460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGCAGATGTCTTAGGTG -3'
(R):5'- TCACAGCACAGAAGGTCCTC -3'

Sequencing Primer
(F):5'- CCTGCAGATGTCTTAGGTGTGTTG -3'
(R):5'- AGAAGGTCCTCTGCTGCTCTG -3'
Posted On2018-05-04