Incidental Mutation 'R6378:Sorcs1'
ID 515166
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 044528-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6378 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50213615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 704 (E704V)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000072685
AA Change: E704V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: E704V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111756
AA Change: E704V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: E704V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164039
AA Change: E704V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: E704V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209413
AA Change: E704V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: E704V

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211008
AA Change: E704V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211687
AA Change: E704V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 72,995,774 (GRCm39) D408E probably benign Het
Agpat2 T C 2: 26,486,147 (GRCm39) N178S probably benign Het
Arsi T C 18: 61,049,573 (GRCm39) F152S probably damaging Het
Atp13a2 T A 4: 140,734,367 (GRCm39) L1163Q probably benign Het
Bpifb2 T A 2: 153,733,072 (GRCm39) L385Q possibly damaging Het
C330018D20Rik A G 18: 57,095,579 (GRCm39) L2P probably damaging Het
Cby3 A G 11: 50,250,360 (GRCm39) T189A probably damaging Het
Cdc42bpa A T 1: 179,921,561 (GRCm39) D567V possibly damaging Het
Cdh5 T A 8: 104,853,168 (GRCm39) probably null Het
Cela1 C T 15: 100,585,071 (GRCm39) V20I probably benign Het
Cmpk2 G A 12: 26,519,415 (GRCm39) G22E possibly damaging Het
Ctcf T A 8: 106,390,423 (GRCm39) V10E possibly damaging Het
Dpp10 C A 1: 123,339,468 (GRCm39) C353F probably damaging Het
Efcab3 A G 11: 104,999,620 (GRCm39) S5546G possibly damaging Het
Elp3 G T 14: 65,830,420 (GRCm39) Y10* probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Eml4 T A 17: 83,755,646 (GRCm39) W336R probably damaging Het
Erich6 T C 3: 58,529,780 (GRCm39) probably null Het
Eya1 T C 1: 14,373,027 (GRCm39) N31D possibly damaging Het
Fam81a T A 9: 70,017,628 (GRCm39) N106Y probably damaging Het
Frrs1 A G 3: 116,694,639 (GRCm39) T487A possibly damaging Het
Ganc T C 2: 120,264,307 (GRCm39) M420T probably damaging Het
Gimap7 A T 6: 48,701,116 (GRCm39) E234V probably damaging Het
Gpbp1 T C 13: 111,570,146 (GRCm39) N400S probably damaging Het
Gucy2g T C 19: 55,229,377 (GRCm39) S98G probably benign Het
Hoxd10 T C 2: 74,524,678 (GRCm39) I330T possibly damaging Het
Ik T A 18: 36,890,341 (GRCm39) I539N probably damaging Het
Il17rb G A 14: 29,722,320 (GRCm39) T237I probably damaging Het
Ing2 T A 8: 48,122,293 (GRCm39) Q85L probably benign Het
Lrp4 C A 2: 91,324,174 (GRCm39) N1208K probably benign Het
Lvrn T A 18: 47,028,024 (GRCm39) S888R probably benign Het
Map2 T C 1: 66,454,488 (GRCm39) V1126A probably damaging Het
Mapkapk5 A G 5: 121,677,233 (GRCm39) probably null Het
Mis18bp1 T C 12: 65,196,021 (GRCm39) D581G probably benign Het
Muc4 T C 16: 32,599,320 (GRCm39) V3289A probably benign Het
Myom2 T A 8: 15,149,356 (GRCm39) I609N probably benign Het
Nav1 A T 1: 135,382,433 (GRCm39) M1343K probably damaging Het
Ndufaf1 T C 2: 119,486,207 (GRCm39) I302V probably damaging Het
Neb T A 2: 52,183,733 (GRCm39) K978N probably damaging Het
Nol8 A G 13: 49,820,831 (GRCm39) E878G probably damaging Het
Nrde2 A T 12: 100,097,016 (GRCm39) I928N probably damaging Het
Nxf1 T A 19: 8,741,910 (GRCm39) D145E probably benign Het
Obox3 T A 7: 15,360,027 (GRCm39) H214L probably benign Het
Obscn T C 11: 58,964,572 (GRCm39) E3199G probably damaging Het
Ogfod3 T C 11: 121,093,761 (GRCm39) E83G probably benign Het
Or11a4 T A 17: 37,536,688 (GRCm39) V224E probably benign Het
Or2r3 T G 6: 42,448,687 (GRCm39) M142L probably benign Het
Or6b2 A G 1: 92,408,178 (GRCm39) L55P probably damaging Het
Or8s8 T C 15: 98,354,425 (GRCm39) V78A probably benign Het
Pcsk4 G T 10: 80,164,809 (GRCm39) H69N probably benign Het
Plcl2 C T 17: 50,975,188 (GRCm39) probably null Het
Pmfbp1 T C 8: 110,256,898 (GRCm39) I534T probably damaging Het
Prss23 A T 7: 89,159,241 (GRCm39) I276N probably damaging Het
Ramac A G 7: 81,417,387 (GRCm39) Y29C probably damaging Het
Rhd T A 4: 134,621,696 (GRCm39) F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,229,115 (GRCm39) probably benign Homo
Scg5 A G 2: 113,657,737 (GRCm39) V58A possibly damaging Het
Scn5a C T 9: 119,315,102 (GRCm39) G1868R probably damaging Het
Secisbp2l A G 2: 125,610,245 (GRCm39) S225P possibly damaging Het
Sema4f A T 6: 82,894,613 (GRCm39) L486* probably null Het
Slc25a47 G A 12: 108,822,069 (GRCm39) R286H probably damaging Het
Slc5a8 A C 10: 88,740,916 (GRCm39) K277T probably damaging Het
Slc66a3 T C 12: 17,047,644 (GRCm39) Y96C probably damaging Het
Sptan1 T C 2: 29,908,527 (GRCm39) S1768P probably damaging Het
Srd5a2 C T 17: 74,328,378 (GRCm39) probably null Het
Sytl2 A T 7: 90,007,432 (GRCm39) K65* probably null Het
Tas2r109 T G 6: 132,957,844 (GRCm39) I29L probably benign Het
Tfap2a A T 13: 40,876,717 (GRCm39) V234E possibly damaging Het
Tgfbr3 G A 5: 107,325,679 (GRCm39) L128F probably benign Het
Trappc12 A T 12: 28,797,082 (GRCm39) L150Q probably damaging Het
Trim43b T A 9: 88,967,452 (GRCm39) I395L probably benign Het
U2surp C T 9: 95,373,474 (GRCm39) E232K probably benign Het
Vax1 T C 19: 59,154,656 (GRCm39) N327S probably benign Het
Vmn1r14 T C 6: 57,210,587 (GRCm39) V11A probably benign Het
Vmn1r60 A G 7: 5,547,782 (GRCm39) V106A probably damaging Het
Vmn2r106 T C 17: 20,498,667 (GRCm39) S415G probably benign Het
Vmn2r3 C T 3: 64,182,517 (GRCm39) G394D probably damaging Het
Ybx2 A G 11: 69,831,179 (GRCm39) E63G possibly damaging Het
Zfhx4 T A 3: 5,308,410 (GRCm39) N545K probably benign Het
Zp1 T C 19: 10,892,217 (GRCm39) T56A probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGATGTGGCCAAGAGAG -3'
(R):5'- ATAGCGTGAATTGGGTTCCC -3'

Sequencing Primer
(F):5'- ATAAGGTCTGCCACTTAGCG -3'
(R):5'- GCTGCAGGAGAAGTCTAATC -3'
Posted On 2018-05-04