Incidental Mutation 'R6379:Nfasc'
ID 515172
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Name neurofascin
Synonyms D430023G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6379 (G1)
Quality Score 189.009
Status Not validated
Chromosome 1
Chromosomal Location 132564690-132741797 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 132570542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1308 (Q1308*)
Ref Sequence ENSEMBL: ENSMUSP00000139955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861]
AlphaFold Q810U3
Predicted Effect probably null
Transcript: ENSMUST00000043189
AA Change: Q1118*
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: Q1118*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094569
AA Change: Q1201*
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: Q1201*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163770
AA Change: Q1135*
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: Q1135*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186389
AA Change: Q1119*
Predicted Effect probably null
Transcript: ENSMUST00000187861
AA Change: Q1308*
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: Q1308*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
Fascist UTSW 1 132611605 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
Partisan UTSW 1 132605549 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 splice site probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7938:Nfasc UTSW 1 132605531 missense probably damaging 1.00
R8083:Nfasc UTSW 1 132596582 missense probably benign 0.00
R8482:Nfasc UTSW 1 132605089 missense probably damaging 1.00
R9027:Nfasc UTSW 1 132611605 missense probably damaging 1.00
R9164:Nfasc UTSW 1 132634806 missense probably damaging 1.00
R9488:Nfasc UTSW 1 132600128 missense possibly damaging 0.68
R9651:Nfasc UTSW 1 132600053 missense probably benign 0.04
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACCCTTGTCCCTGAAGG -3'
(R):5'- ATCCCACCTGGTTTGAGCTG -3'

Sequencing Primer
(F):5'- AGGTCTGCAGTTGCTTCATC -3'
(R):5'- TGAGCTGTGCTGGCCAGTC -3'
Posted On 2018-05-04