Incidental Mutation 'R6379:Dpysl5'
ID515190
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Namedihydropyrimidinase-like 5
SynonymsCRAM, CRMP-5, Crmp5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30711564-30799375 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 30777973 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000088081] [ENSMUST00000114729] [ENSMUST00000114729]
Predicted Effect probably null
Transcript: ENSMUST00000088081
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088081
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114729
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114729
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127365
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30745278 missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30788781 missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30778066 missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30788841 critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30777994 missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30792268 missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30784343 missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30792268 missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30791513 missense probably damaging 1.00
R6621:Dpysl5 UTSW 5 30784469 critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30783195 missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30792298 missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30745461 missense probably benign
R7446:Dpysl5 UTSW 5 30778887 missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30745416 missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30796314 missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30745467 missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30778938 critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30745343 missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30778031 missense probably benign 0.33
Z1176:Dpysl5 UTSW 5 30778120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGATGAGGTACCAGGAACATC -3'
(R):5'- CAACGACCTCAGTTGCAGAC -3'

Sequencing Primer
(F):5'- ACATCTAGTGGGTAGTACCGC -3'
(R):5'- AGACTTGCCTCAGCCACGAG -3'
Posted On2018-05-04