Incidental Mutation 'R6379:Lrrc8d'
ID 515192
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Name leucine rich repeat containing 8D
Synonyms 2810473G09Rik, 4930525N13Rik, Lrrc5
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 105847829-105963081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105960675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 362 (M362L)
Ref Sequence ENSEMBL: ENSMUSP00000113603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060531] [ENSMUST00000120847] [ENSMUST00000127686] [ENSMUST00000154807] [ENSMUST00000156630]
AlphaFold Q8BGR2
Predicted Effect probably benign
Transcript: ENSMUST00000060531
AA Change: M362L

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057293
Gene: ENSMUSG00000046079
AA Change: M362L

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 5.6e-31 PFAM
Pfam:DUF3733 138 197 2e-24 PFAM
transmembrane domain 366 388 N/A INTRINSIC
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120847
AA Change: M362L

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113603
Gene: ENSMUSG00000046079
AA Change: M362L

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 385 2.2e-160 PFAM
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149831
Predicted Effect probably benign
Transcript: ENSMUST00000154807
SMART Domains Protein: ENSMUSP00000114662
Gene: ENSMUSG00000046079

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A T 2: 152,269,912 (GRCm39) R21S probably benign Het
Aadacl4fm1 G T 4: 144,248,912 (GRCm39) R93L probably benign Het
Adcy5 A T 16: 35,114,369 (GRCm39) T991S probably benign Het
Aldh18a1 A T 19: 40,566,214 (GRCm39) probably null Het
Anxa1 T C 19: 20,351,079 (GRCm39) *347W probably null Het
Aopep T A 13: 63,216,057 (GRCm39) I443K probably damaging Het
Arid1a G T 4: 133,408,238 (GRCm39) L2090I unknown Het
Armh3 A T 19: 45,910,136 (GRCm39) V472D possibly damaging Het
Bambi T A 18: 3,512,198 (GRCm39) L194Q probably damaging Het
Card9 A G 2: 26,246,789 (GRCm39) V353A probably damaging Het
Ccdc198 T A 14: 49,481,191 (GRCm39) I99F probably benign Het
Ccdc60 C A 5: 116,269,082 (GRCm39) probably null Het
Ccdc71 A G 9: 108,340,811 (GRCm39) K208R possibly damaging Het
Cdh12 T C 15: 21,492,743 (GRCm39) V254A probably benign Het
Cep295nl T A 11: 118,224,556 (GRCm39) N96I probably benign Het
Ces1f C A 8: 94,006,279 (GRCm39) C17F probably benign Het
Clic6 C A 16: 92,336,423 (GRCm39) T577K probably damaging Het
Col28a1 T C 6: 8,012,996 (GRCm39) M1019V probably benign Het
Ctnnd2 C A 15: 30,634,844 (GRCm39) S73Y probably damaging Het
Daam1 C T 12: 71,998,712 (GRCm39) L556F unknown Het
Dchs2 A C 3: 83,262,453 (GRCm39) N2907T probably damaging Het
Dlgap3 A C 4: 127,128,767 (GRCm39) E829A probably damaging Het
Dpysl5 A T 5: 30,935,317 (GRCm39) probably null Het
Draxin C A 4: 148,192,400 (GRCm39) C304F probably damaging Het
Eif3j1 A G 2: 121,878,005 (GRCm39) D131G possibly damaging Het
Fads1 T C 19: 10,160,551 (GRCm39) Y46H probably damaging Het
Fcgbpl1 A C 7: 27,857,017 (GRCm39) T2122P probably damaging Het
Figla T A 6: 85,995,562 (GRCm39) I72K probably damaging Het
Fnbp4 T A 2: 90,581,468 (GRCm39) S174T probably benign Het
Foxn3 C A 12: 99,162,537 (GRCm39) A455S probably benign Het
Fyn C T 10: 39,331,070 (GRCm39) probably benign Het
Gtse1 G A 15: 85,748,425 (GRCm39) G277S probably benign Het
H2bc15 T A 13: 21,938,588 (GRCm39) V99E probably benign Het
Icam4 C A 9: 20,941,078 (GRCm39) A110E probably damaging Het
Itih3 G A 14: 30,631,681 (GRCm39) S802L probably damaging Het
Kcng4 T A 8: 120,360,359 (GRCm39) R6* probably null Het
Kmt2c A T 5: 25,564,339 (GRCm39) C977S probably damaging Het
Mtus2 T C 5: 148,014,008 (GRCm39) I267T probably benign Het
Nab1 A G 1: 52,520,156 (GRCm39) V275A probably damaging Het
Nfasc G A 1: 132,498,280 (GRCm39) Q1308* probably null Het
Nop9 T C 14: 55,983,249 (GRCm39) S7P possibly damaging Het
Npbwr1 G T 1: 5,987,438 (GRCm39) N25K probably benign Het
Nptx2 T C 5: 144,490,252 (GRCm39) L227P probably damaging Het
Nrg1 T C 8: 33,373,749 (GRCm39) probably benign Het
Nup160 T A 2: 90,532,753 (GRCm39) C571* probably null Het
Nynrin T C 14: 56,107,848 (GRCm39) L985P probably damaging Het
Obsl1 A C 1: 75,479,787 (GRCm39) L341R probably damaging Het
Or1r1 T G 11: 73,875,099 (GRCm39) S112R probably damaging Het
Pate7 T A 9: 35,689,381 (GRCm39) probably benign Het
Phip G T 9: 82,795,910 (GRCm39) N570K probably damaging Het
Pigx A T 16: 31,903,341 (GRCm39) I240N probably damaging Het
Platr25 T C 13: 62,854,051 (GRCm39) D37G probably damaging Het
Ppl A T 16: 4,915,555 (GRCm39) M639K probably benign Het
Scnn1b T G 7: 121,514,551 (GRCm39) M441R probably benign Het
Sh3gl1 A T 17: 56,326,143 (GRCm39) M121K probably damaging Het
Slc30a4 A T 2: 122,531,469 (GRCm39) V132D probably damaging Het
Slc38a7 A G 8: 96,575,155 (GRCm39) S42P probably benign Het
Slc66a1 G A 4: 139,027,296 (GRCm39) L349F probably benign Het
Srp68 A G 11: 116,156,227 (GRCm39) C172R probably damaging Het
Suz12 A T 11: 79,906,014 (GRCm39) D292V possibly damaging Het
Sv2b A T 7: 74,786,048 (GRCm39) D457E possibly damaging Het
Tas2r120 T C 6: 132,634,773 (GRCm39) V285A probably benign Het
Tdo2 T A 3: 81,866,102 (GRCm39) probably benign Het
Them7 G T 2: 105,115,031 (GRCm39) probably null Het
Tnip2 T C 5: 34,660,979 (GRCm39) T158A probably damaging Het
Tonsl C T 15: 76,513,942 (GRCm39) R1209H probably benign Het
Trpc2 T A 7: 101,745,298 (GRCm39) L838* probably null Het
Trpm1 A G 7: 63,848,942 (GRCm39) I63V probably benign Het
Vps13d A T 4: 144,814,828 (GRCm39) N90K probably benign Het
Ylpm1 C T 12: 85,077,574 (GRCm39) S1433F probably damaging Het
Zbtb18 A G 1: 177,275,141 (GRCm39) D158G probably damaging Het
Zfhx2 T A 14: 55,311,795 (GRCm39) T300S probably benign Het
Zscan2 T A 7: 80,513,085 (GRCm39) D23E probably benign Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105,959,818 (GRCm39) missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105,960,131 (GRCm39) missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105,960,253 (GRCm39) missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105,959,730 (GRCm39) missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105,961,414 (GRCm39) missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105,974,683 (GRCm39) intron noncoding transcript
heehaw UTSW 5 105,960,957 (GRCm39) missense probably damaging 1.00
hoot UTSW 5 105,959,626 (GRCm39) missense probably damaging 1.00
BB009:Lrrc8d UTSW 5 105,960,891 (GRCm39) missense probably damaging 1.00
BB019:Lrrc8d UTSW 5 105,960,891 (GRCm39) missense probably damaging 1.00
R0415:Lrrc8d UTSW 5 105,959,731 (GRCm39) missense probably damaging 1.00
R1424:Lrrc8d UTSW 5 105,974,782 (GRCm39) missense unknown
R1754:Lrrc8d UTSW 5 105,960,523 (GRCm39) missense probably benign
R3411:Lrrc8d UTSW 5 105,974,572 (GRCm39) intron noncoding transcript
R3605:Lrrc8d UTSW 5 105,974,873 (GRCm39) missense unknown
R3705:Lrrc8d UTSW 5 105,961,341 (GRCm39) missense probably damaging 1.00
R3798:Lrrc8d UTSW 5 105,960,355 (GRCm39) missense probably benign 0.12
R3951:Lrrc8d UTSW 5 105,962,142 (GRCm39) missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105,961,606 (GRCm39) missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105,961,234 (GRCm39) missense probably damaging 1.00
R5211:Lrrc8d UTSW 5 105,961,606 (GRCm39) missense probably damaging 0.99
R5436:Lrrc8d UTSW 5 105,960,418 (GRCm39) missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105,960,650 (GRCm39) missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105,960,651 (GRCm39) missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105,960,651 (GRCm39) missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105,960,650 (GRCm39) missense probably damaging 1.00
R5531:Lrrc8d UTSW 5 105,945,536 (GRCm39) intron probably benign
R5929:Lrrc8d UTSW 5 105,960,472 (GRCm39) missense probably damaging 0.98
R6063:Lrrc8d UTSW 5 105,959,992 (GRCm39) missense probably benign 0.01
R6431:Lrrc8d UTSW 5 105,959,626 (GRCm39) missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105,960,829 (GRCm39) missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105,960,657 (GRCm39) missense probably damaging 1.00
R7821:Lrrc8d UTSW 5 105,960,210 (GRCm39) missense probably damaging 1.00
R7932:Lrrc8d UTSW 5 105,960,891 (GRCm39) missense probably damaging 1.00
R8528:Lrrc8d UTSW 5 105,960,352 (GRCm39) missense probably benign 0.22
R8976:Lrrc8d UTSW 5 105,960,957 (GRCm39) missense probably damaging 1.00
R9063:Lrrc8d UTSW 5 105,961,959 (GRCm39) missense probably damaging 0.97
R9116:Lrrc8d UTSW 5 105,961,908 (GRCm39) missense probably damaging 1.00
R9211:Lrrc8d UTSW 5 105,960,216 (GRCm39) missense probably damaging 1.00
R9358:Lrrc8d UTSW 5 105,960,358 (GRCm39) missense probably benign 0.01
R9388:Lrrc8d UTSW 5 105,961,862 (GRCm39) missense probably damaging 0.97
R9796:Lrrc8d UTSW 5 105,959,917 (GRCm39) missense probably benign 0.01
RF003:Lrrc8d UTSW 5 105,960,507 (GRCm39) missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105,959,611 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGGAAGACAGTGACTTGATC -3'
(R):5'- ATAGAGCTGGTCGTACTGGTC -3'

Sequencing Primer
(F):5'- CTATAAGCTCTATGTGGTCCAAACGC -3'
(R):5'- TACTGGTCGACCATGTGCAG -3'
Posted On 2018-05-04