Incidental Mutation 'R6379:Trpm1'
ID 515200
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63848942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 63 (I63V)
Ref Sequence ENSEMBL: ENSMUSP00000145708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206706] [ENSMUST00000205731] [ENSMUST00000206049]
AlphaFold Q2TV84
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I63V

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177102
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000205348
AA Change: I63V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect probably benign
Transcript: ENSMUST00000205690
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206453
Predicted Effect probably benign
Transcript: ENSMUST00000206107
Predicted Effect probably benign
Transcript: ENSMUST00000206263
Predicted Effect probably benign
Transcript: ENSMUST00000206706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205960
Predicted Effect probably benign
Transcript: ENSMUST00000205731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205728
Predicted Effect probably benign
Transcript: ENSMUST00000206049
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A T 2: 152,269,912 (GRCm39) R21S probably benign Het
Aadacl4fm1 G T 4: 144,248,912 (GRCm39) R93L probably benign Het
Adcy5 A T 16: 35,114,369 (GRCm39) T991S probably benign Het
Aldh18a1 A T 19: 40,566,214 (GRCm39) probably null Het
Anxa1 T C 19: 20,351,079 (GRCm39) *347W probably null Het
Aopep T A 13: 63,216,057 (GRCm39) I443K probably damaging Het
Arid1a G T 4: 133,408,238 (GRCm39) L2090I unknown Het
Armh3 A T 19: 45,910,136 (GRCm39) V472D possibly damaging Het
Bambi T A 18: 3,512,198 (GRCm39) L194Q probably damaging Het
Card9 A G 2: 26,246,789 (GRCm39) V353A probably damaging Het
Ccdc198 T A 14: 49,481,191 (GRCm39) I99F probably benign Het
Ccdc60 C A 5: 116,269,082 (GRCm39) probably null Het
Ccdc71 A G 9: 108,340,811 (GRCm39) K208R possibly damaging Het
Cdh12 T C 15: 21,492,743 (GRCm39) V254A probably benign Het
Cep295nl T A 11: 118,224,556 (GRCm39) N96I probably benign Het
Ces1f C A 8: 94,006,279 (GRCm39) C17F probably benign Het
Clic6 C A 16: 92,336,423 (GRCm39) T577K probably damaging Het
Col28a1 T C 6: 8,012,996 (GRCm39) M1019V probably benign Het
Ctnnd2 C A 15: 30,634,844 (GRCm39) S73Y probably damaging Het
Daam1 C T 12: 71,998,712 (GRCm39) L556F unknown Het
Dchs2 A C 3: 83,262,453 (GRCm39) N2907T probably damaging Het
Dlgap3 A C 4: 127,128,767 (GRCm39) E829A probably damaging Het
Dpysl5 A T 5: 30,935,317 (GRCm39) probably null Het
Draxin C A 4: 148,192,400 (GRCm39) C304F probably damaging Het
Eif3j1 A G 2: 121,878,005 (GRCm39) D131G possibly damaging Het
Fads1 T C 19: 10,160,551 (GRCm39) Y46H probably damaging Het
Fcgbpl1 A C 7: 27,857,017 (GRCm39) T2122P probably damaging Het
Figla T A 6: 85,995,562 (GRCm39) I72K probably damaging Het
Fnbp4 T A 2: 90,581,468 (GRCm39) S174T probably benign Het
Foxn3 C A 12: 99,162,537 (GRCm39) A455S probably benign Het
Fyn C T 10: 39,331,070 (GRCm39) probably benign Het
Gtse1 G A 15: 85,748,425 (GRCm39) G277S probably benign Het
H2bc15 T A 13: 21,938,588 (GRCm39) V99E probably benign Het
Icam4 C A 9: 20,941,078 (GRCm39) A110E probably damaging Het
Itih3 G A 14: 30,631,681 (GRCm39) S802L probably damaging Het
Kcng4 T A 8: 120,360,359 (GRCm39) R6* probably null Het
Kmt2c A T 5: 25,564,339 (GRCm39) C977S probably damaging Het
Lrrc8d A T 5: 105,960,675 (GRCm39) M362L probably benign Het
Mtus2 T C 5: 148,014,008 (GRCm39) I267T probably benign Het
Nab1 A G 1: 52,520,156 (GRCm39) V275A probably damaging Het
Nfasc G A 1: 132,498,280 (GRCm39) Q1308* probably null Het
Nop9 T C 14: 55,983,249 (GRCm39) S7P possibly damaging Het
Npbwr1 G T 1: 5,987,438 (GRCm39) N25K probably benign Het
Nptx2 T C 5: 144,490,252 (GRCm39) L227P probably damaging Het
Nrg1 T C 8: 33,373,749 (GRCm39) probably benign Het
Nup160 T A 2: 90,532,753 (GRCm39) C571* probably null Het
Nynrin T C 14: 56,107,848 (GRCm39) L985P probably damaging Het
Obsl1 A C 1: 75,479,787 (GRCm39) L341R probably damaging Het
Or1r1 T G 11: 73,875,099 (GRCm39) S112R probably damaging Het
Pate7 T A 9: 35,689,381 (GRCm39) probably benign Het
Phip G T 9: 82,795,910 (GRCm39) N570K probably damaging Het
Pigx A T 16: 31,903,341 (GRCm39) I240N probably damaging Het
Platr25 T C 13: 62,854,051 (GRCm39) D37G probably damaging Het
Ppl A T 16: 4,915,555 (GRCm39) M639K probably benign Het
Scnn1b T G 7: 121,514,551 (GRCm39) M441R probably benign Het
Sh3gl1 A T 17: 56,326,143 (GRCm39) M121K probably damaging Het
Slc30a4 A T 2: 122,531,469 (GRCm39) V132D probably damaging Het
Slc38a7 A G 8: 96,575,155 (GRCm39) S42P probably benign Het
Slc66a1 G A 4: 139,027,296 (GRCm39) L349F probably benign Het
Srp68 A G 11: 116,156,227 (GRCm39) C172R probably damaging Het
Suz12 A T 11: 79,906,014 (GRCm39) D292V possibly damaging Het
Sv2b A T 7: 74,786,048 (GRCm39) D457E possibly damaging Het
Tas2r120 T C 6: 132,634,773 (GRCm39) V285A probably benign Het
Tdo2 T A 3: 81,866,102 (GRCm39) probably benign Het
Them7 G T 2: 105,115,031 (GRCm39) probably null Het
Tnip2 T C 5: 34,660,979 (GRCm39) T158A probably damaging Het
Tonsl C T 15: 76,513,942 (GRCm39) R1209H probably benign Het
Trpc2 T A 7: 101,745,298 (GRCm39) L838* probably null Het
Vps13d A T 4: 144,814,828 (GRCm39) N90K probably benign Het
Ylpm1 C T 12: 85,077,574 (GRCm39) S1433F probably damaging Het
Zbtb18 A G 1: 177,275,141 (GRCm39) D158G probably damaging Het
Zfhx2 T A 14: 55,311,795 (GRCm39) T300S probably benign Het
Zscan2 T A 7: 80,513,085 (GRCm39) D23E probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAATGGGCATTTCAGGGGAC -3'
(R):5'- GAAGGCTAAGTTGCTTTGTACAGC -3'

Sequencing Primer
(F):5'- GACACCTCTGTCCCTGATAAAGCTG -3'
(R):5'- GCTTTGTACAGCACCCCATCAC -3'
Posted On 2018-05-04