Mutagenetix > Incidental Mutation

Incidental Mutation 'R6379:Trpm1'

515200

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6379 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64199194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 63 (I63V)

Ref Sequence

ENSEMBL: ENSMUSP00000145708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I63V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348
AA Change: I63V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000205690

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205728

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205960

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

probably benign
Transcript: ENSMUST00000206107

Predicted Effect

probably benign
Transcript: ENSMUST00000206263

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206453

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206473

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	A	14: 49,243,734	I99F	probably benign	Het
2010111I01Rik	T	A	13: 63,068,243	I443K	probably damaging	Het
6820408C15Rik	A	T	2: 152,427,992	R21S	probably benign	Het
9130011E15Rik	A	T	19: 45,921,697	V472D	possibly damaging	Het
9430007A20Rik	G	T	4: 144,522,342	R93L	probably benign	Het
9530053A07Rik	A	C	7: 28,157,592	T2122P	probably damaging	Het
Adcy5	A	T	16: 35,293,999	T991S	probably benign	Het
Aldh18a1	A	T	19: 40,577,770		probably null	Het
Anxa1	T	C	19: 20,373,715	*347W	probably null	Het
Arid1a	G	T	4: 133,680,927	L2090I	unknown	Het
Bambi	T	A	18: 3,512,198	L194Q	probably damaging	Het
Card9	A	G	2: 26,356,777	V353A	probably damaging	Het
Ccdc60	C	A	5: 116,131,023		probably null	Het
Ccdc71	A	G	9: 108,463,612	K208R	possibly damaging	Het
Cdh12	T	C	15: 21,492,657	V254A	probably benign	Het
Cep295nl	T	A	11: 118,333,730	N96I	probably benign	Het
Ces1f	C	A	8: 93,279,651	C17F	probably benign	Het
Clic6	C	A	16: 92,539,535	T577K	probably damaging	Het
Col28a1	T	C	6: 8,012,996	M1019V	probably benign	Het
Ctnnd2	C	A	15: 30,634,698	S73Y	probably damaging	Het
Daam1	C	T	12: 71,951,938	L556F	unknown	Het
Dchs2	A	C	3: 83,355,146	N2907T	probably damaging	Het
Dlgap3	A	C	4: 127,234,974	E829A	probably damaging	Het
Dpysl5	A	T	5: 30,777,973		probably null	Het
Draxin	C	A	4: 148,107,943	C304F	probably damaging	Het
Eif3j1	A	G	2: 122,047,524	D131G	possibly damaging	Het
Fads1	T	C	19: 10,183,187	Y46H	probably damaging	Het
Figla	T	A	6: 86,018,580	I72K	probably damaging	Het
Fnbp4	T	A	2: 90,751,124	S174T	probably benign	Het
Foxn3	C	A	12: 99,196,278	A455S	probably benign	Het
Fyn	C	T	10: 39,455,074		probably benign	Het
Gm17727	T	A	9: 35,778,085		probably benign	Het
Gtse1	G	A	15: 85,864,224	G277S	probably benign	Het
Hist1h2bn	T	A	13: 21,754,418	V99E	probably benign	Het
Icam4	C	A	9: 21,029,782	A110E	probably damaging	Het
Itih3	G	A	14: 30,909,724	S802L	probably damaging	Het
Kcng4	T	A	8: 119,633,620	R6*	probably null	Het
Kmt2c	A	T	5: 25,359,341	C977S	probably damaging	Het
Lrrc8d	A	T	5: 105,812,809	M362L	probably benign	Het
Mtus2	T	C	5: 148,077,198	I267T	probably benign	Het
Nab1	A	G	1: 52,480,997	V275A	probably damaging	Het
Nfasc	G	A	1: 132,570,542	Q1308*	probably null	Het
Nop9	T	C	14: 55,745,792	S7P	possibly damaging	Het
Npbwr1	G	T	1: 5,917,219	N25K	probably benign	Het
Nptx2	T	C	5: 144,553,442	L227P	probably damaging	Het
Nrg1	T	C	8: 32,883,721		probably benign	Het
Nup160	T	A	2: 90,702,409	C571*	probably null	Het
Nynrin	T	C	14: 55,870,391	L985P	probably damaging	Het
Obsl1	A	C	1: 75,503,143	L341R	probably damaging	Het
Olfr398	T	G	11: 73,984,273	S112R	probably damaging	Het
Phip	G	T	9: 82,913,857	N570K	probably damaging	Het
Pigx	A	T	16: 32,084,523	I240N	probably damaging	Het
Platr25	T	C	13: 62,706,237	D37G	probably damaging	Het
Ppl	A	T	16: 5,097,691	M639K	probably benign	Het
Pqlc2	G	A	4: 139,299,985	L349F	probably benign	Het
Scnn1b	T	G	7: 121,915,328	M441R	probably benign	Het
Sh3gl1	A	T	17: 56,019,143	M121K	probably damaging	Het
Slc30a4	A	T	2: 122,689,549	V132D	probably damaging	Het
Slc38a7	A	G	8: 95,848,527	S42P	probably benign	Het
Srp68	A	G	11: 116,265,401	C172R	probably damaging	Het
Suz12	A	T	11: 80,015,188	D292V	possibly damaging	Het
Sv2b	A	T	7: 75,136,300	D457E	possibly damaging	Het
Tas2r120	T	C	6: 132,657,810	V285A	probably benign	Het
Tdo2	T	A	3: 81,958,795		probably benign	Het
Them7	G	T	2: 105,284,686		probably null	Het
Tnip2	T	C	5: 34,503,635	T158A	probably damaging	Het
Tonsl	C	T	15: 76,629,742	R1209H	probably benign	Het
Trpc2	T	A	7: 102,096,091	L838*	probably null	Het
Vps13d	A	T	4: 145,088,258	N90K	probably benign	Het
Ylpm1	C	T	12: 85,030,800	S1433F	probably damaging	Het
Zbtb18	A	G	1: 177,447,575	D158G	probably damaging	Het
Zfhx2	T	A	14: 55,074,338	T300S	probably benign	Het
Zscan2	T	A	7: 80,863,337	D23E	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAATGGGCATTTCAGGGGAC -3'
(R):5'- GAAGGCTAAGTTGCTTTGTACAGC -3'

Sequencing Primer
(F):5'- GACACCTCTGTCCCTGATAAAGCTG -3'
(R):5'- GCTTTGTACAGCACCCCATCAC -3'

Posted On

2018-05-04