Incidental Mutation 'R6379:Zscan2'
ID515202
Institutional Source Beutler Lab
Gene Symbol Zscan2
Ensembl Gene ENSMUSG00000038797
Gene Namezinc finger and SCAN domain containing 2
SynonymsZfp-29, Zfp29
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80860920-80876537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80863337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 23 (D23E)
Ref Sequence ENSEMBL: ENSMUSP00000146233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044115] [ENSMUST00000132163] [ENSMUST00000147125] [ENSMUST00000155128] [ENSMUST00000205361]
Predicted Effect probably benign
Transcript: ENSMUST00000044115
AA Change: D23E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042321
Gene: ENSMUSG00000038797
AA Change: D23E

DomainStartEndE-ValueType
SCAN 64 160 3.18e-21 SMART
low complexity region 164 177 N/A INTRINSIC
ZnF_C2H2 222 244 3.49e-5 SMART
ZnF_C2H2 250 272 5.21e-4 SMART
ZnF_C2H2 278 300 1.72e-4 SMART
ZnF_C2H2 306 328 3.69e-4 SMART
ZnF_C2H2 334 356 9.88e-5 SMART
ZnF_C2H2 362 384 4.87e-4 SMART
ZnF_C2H2 390 412 2.43e-4 SMART
ZnF_C2H2 418 440 1.69e-3 SMART
ZnF_C2H2 446 468 2.4e-3 SMART
ZnF_C2H2 474 496 1.69e-3 SMART
ZnF_C2H2 502 524 3.21e-4 SMART
ZnF_C2H2 530 552 1.92e-2 SMART
ZnF_C2H2 558 580 4.24e-4 SMART
ZnF_C2H2 586 608 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132163
AA Change: D23E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118774
Gene: ENSMUSG00000038797
AA Change: D23E

DomainStartEndE-ValueType
SCAN 64 144 5.98e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147125
AA Change: D23E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121143
Gene: ENSMUSG00000038797
AA Change: D23E

DomainStartEndE-ValueType
SCAN 64 160 3.18e-21 SMART
low complexity region 164 177 N/A INTRINSIC
ZnF_C2H2 222 244 3.49e-5 SMART
ZnF_C2H2 250 272 5.21e-4 SMART
ZnF_C2H2 278 300 1.72e-4 SMART
ZnF_C2H2 306 328 3.69e-4 SMART
ZnF_C2H2 334 356 9.88e-5 SMART
ZnF_C2H2 362 384 4.87e-4 SMART
ZnF_C2H2 390 412 2.43e-4 SMART
ZnF_C2H2 418 440 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155128
AA Change: D23E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117886
Gene: ENSMUSG00000038797
AA Change: D23E

DomainStartEndE-ValueType
SCAN 64 160 3.18e-21 SMART
low complexity region 164 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205361
AA Change: D23E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several copies of zinc finger motif, which is commonly found in transcriptional regulatory proteins. Studies in mice show that this gene is expressed during embryonic development, and specifically in the testis in adult mice, suggesting that it may play a role in regulating genes in germ cells. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Other mutations in Zscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Zscan2 APN 7 80875416 missense probably damaging 1.00
IGL01793:Zscan2 APN 7 80874944 missense probably null 0.79
R1570:Zscan2 UTSW 7 80863393 missense probably damaging 1.00
R1618:Zscan2 UTSW 7 80875786 nonsense probably null
R1622:Zscan2 UTSW 7 80875386 missense probably benign 0.01
R1842:Zscan2 UTSW 7 80875553 missense probably damaging 1.00
R3122:Zscan2 UTSW 7 80863344 missense probably benign 0.41
R3415:Zscan2 UTSW 7 80875402 missense probably damaging 1.00
R4674:Zscan2 UTSW 7 80875402 missense probably damaging 1.00
R5988:Zscan2 UTSW 7 80876199 missense possibly damaging 0.47
R6276:Zscan2 UTSW 7 80875809 missense probably benign
R7897:Zscan2 UTSW 7 80875700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCGGAGGCTGCTATGAG -3'
(R):5'- GAAATCGGACAAGAGCACCCTG -3'

Sequencing Primer
(F):5'- AGATGGCTGTAGCAGTTTCC -3'
(R):5'- CTGGGGTCCCTCGGCTG -3'
Posted On2018-05-04