Incidental Mutation 'R6379:Ces1f'
ID515206
Institutional Source Beutler Lab
Gene Symbol Ces1f
Ensembl Gene ENSMUSG00000031725
Gene Namecarboxylesterase 1F
SynonymsTGH-2, CesML1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6379 (G1)
Quality Score136.008
Status Not validated
Chromosome8
Chromosomal Location93256236-93279747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93279651 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 17 (C17F)
Ref Sequence ENSEMBL: ENSMUSP00000116525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034178] [ENSMUST00000140026]
Predicted Effect probably benign
Transcript: ENSMUST00000034178
AA Change: C17F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725
AA Change: C17F

DomainStartEndE-ValueType
Pfam:COesterase 1 545 2.5e-166 PFAM
Pfam:Abhydrolase_3 136 244 4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133879
Predicted Effect probably benign
Transcript: ENSMUST00000140026
AA Change: C17F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116525
Gene: ENSMUSG00000031725
AA Change: C17F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Ces1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ces1f APN 8 93267992 missense probably benign
IGL01143:Ces1f APN 8 93271830 critical splice donor site probably null
IGL01571:Ces1f APN 8 93258368 missense probably benign 0.00
IGL01731:Ces1f APN 8 93267320 missense possibly damaging 0.73
IGL01733:Ces1f APN 8 93270014 missense probably damaging 1.00
IGL02124:Ces1f APN 8 93265860 missense possibly damaging 0.54
IGL03058:Ces1f APN 8 93269972 critical splice donor site probably null
IGL03124:Ces1f APN 8 93275384 missense probably benign
3-1:Ces1f UTSW 8 93275431 missense probably benign 0.29
G5030:Ces1f UTSW 8 93274219 missense probably benign 0.03
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0113:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R0201:Ces1f UTSW 8 93267329 missense probably null 0.01
R0306:Ces1f UTSW 8 93276544 splice site probably benign
R0317:Ces1f UTSW 8 93263391 missense probably benign 0.05
R0558:Ces1f UTSW 8 93275389 missense probably benign
R0791:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R0833:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R0836:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R1087:Ces1f UTSW 8 93258295 missense probably damaging 1.00
R1118:Ces1f UTSW 8 93267242 splice site probably benign
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1183:Ces1f UTSW 8 93268005 missense probably benign 0.01
R1371:Ces1f UTSW 8 93279649 missense probably damaging 0.98
R1480:Ces1f UTSW 8 93274154 missense probably benign 0.07
R1522:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R1681:Ces1f UTSW 8 93275414 missense probably benign 0.00
R1865:Ces1f UTSW 8 93274265 splice site probably benign
R2437:Ces1f UTSW 8 93270139 splice site probably null
R3038:Ces1f UTSW 8 93256598 missense probably damaging 1.00
R4199:Ces1f UTSW 8 93256889 missense probably benign 0.00
R4406:Ces1f UTSW 8 93263322 missense probably benign
R5385:Ces1f UTSW 8 93265760 nonsense probably null
R5450:Ces1f UTSW 8 93265795 missense probably benign 0.04
R5627:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R6182:Ces1f UTSW 8 93256496 missense probably benign 0.43
R6256:Ces1f UTSW 8 93265794 missense probably damaging 1.00
R6443:Ces1f UTSW 8 93275365 missense probably benign 0.00
R6967:Ces1f UTSW 8 93267997 missense probably benign 0.00
R7158:Ces1f UTSW 8 93268016 missense probably benign 0.00
R7323:Ces1f UTSW 8 93271844 missense probably damaging 1.00
R7654:Ces1f UTSW 8 93271934 missense probably benign 0.00
R7810:Ces1f UTSW 8 93256918 missense probably damaging 1.00
R7812:Ces1f UTSW 8 93258310 missense probably benign 0.00
R7864:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7947:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7999:Ces1f UTSW 8 93262995 missense possibly damaging 0.77
X0026:Ces1f UTSW 8 93270056 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTGTCTCTTGATCTCAGAGTGTCC -3'
(R):5'- AAACTTGGAAGAGCTGTGGC -3'

Sequencing Primer
(F):5'- TGCTCTATGCACAACCCT -3'
(R):5'- AAGAGAAAGAGGTGTTTGTGTGTG -3'
Posted On2018-05-04