Incidental Mutation 'R6379:Kcng4'
ID515208
Institutional Source Beutler Lab
Gene Symbol Kcng4
Ensembl Gene ENSMUSG00000045246
Gene Namepotassium voltage-gated channel, subfamily G, member 4
SynonymsKV6.4, 4921535I01Rik, KV6.3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location119623854-119635680 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 119633620 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 6 (R6*)
Ref Sequence ENSEMBL: ENSMUSP00000129687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061828] [ENSMUST00000164382]
Predicted Effect probably null
Transcript: ENSMUST00000061828
AA Change: R6*
SMART Domains Protein: ENSMUSP00000056552
Gene: ENSMUSG00000045246
AA Change: R6*

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 218 462 1.2e-40 PFAM
Pfam:Ion_trans_2 370 457 7e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164382
AA Change: R6*
SMART Domains Protein: ENSMUSP00000129687
Gene: ENSMUSG00000045246
AA Change: R6*

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 262 451 6.6e-29 PFAM
Pfam:Ion_trans_2 371 457 1.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Kcng4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Kcng4 APN 8 119626331 missense probably benign 0.00
IGL01360:Kcng4 APN 8 119625677 missense probably benign 0.40
IGL02094:Kcng4 APN 8 119633221 missense probably damaging 0.98
IGL02205:Kcng4 APN 8 119626083 missense probably damaging 0.99
IGL02892:Kcng4 APN 8 119633082 missense probably benign
IGL02927:Kcng4 APN 8 119626322 missense probably benign
IGL02954:Kcng4 APN 8 119633053 missense probably benign
IGL03143:Kcng4 APN 8 119625770 missense probably damaging 1.00
FR4449:Kcng4 UTSW 8 119633519 nonsense probably null
FR4548:Kcng4 UTSW 8 119633519 nonsense probably null
FR4737:Kcng4 UTSW 8 119633519 nonsense probably null
FR4976:Kcng4 UTSW 8 119633519 nonsense probably null
LCD18:Kcng4 UTSW 8 119633519 nonsense probably null
R0017:Kcng4 UTSW 8 119633520 missense probably damaging 1.00
R1777:Kcng4 UTSW 8 119633487 missense probably benign 0.02
R1852:Kcng4 UTSW 8 119626208 missense probably benign 0.01
R1967:Kcng4 UTSW 8 119632923 missense probably damaging 1.00
R3886:Kcng4 UTSW 8 119633247 missense probably benign 0.34
R4009:Kcng4 UTSW 8 119626085 missense probably damaging 1.00
R5137:Kcng4 UTSW 8 119625878 missense possibly damaging 0.88
R5792:Kcng4 UTSW 8 119626279 missense probably damaging 1.00
R5987:Kcng4 UTSW 8 119626359 missense probably damaging 1.00
R6339:Kcng4 UTSW 8 119632954 missense probably damaging 1.00
R6430:Kcng4 UTSW 8 119633050 missense probably damaging 0.96
R7847:Kcng4 UTSW 8 119626142 missense probably damaging 1.00
R8784:Kcng4 UTSW 8 119626231 missense probably benign 0.18
R8947:Kcng4 UTSW 8 119625713 missense possibly damaging 0.78
X0024:Kcng4 UTSW 8 119633367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCACCCACATTCACTAG -3'
(R):5'- TGACACAGCCCAAGCGTATAG -3'

Sequencing Primer
(F):5'- AGGATCTCCTTCAAGTTGGC -3'
(R):5'- GCGTATAGTAGCTGCCCAGTAAAC -3'
Posted On2018-05-04