Incidental Mutation 'R6379:Suz12'
ID 515215
Institutional Source Beutler Lab
Gene Symbol Suz12
Ensembl Gene ENSMUSG00000017548
Gene Name SUZ12 polycomb repressive complex 2 subunit
Synonyms 2610028O16Rik, D11Ertd530e
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 79883932-79924949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79906014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 292 (D292V)
Ref Sequence ENSEMBL: ENSMUSP00000017692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017692] [ENSMUST00000163272]
AlphaFold Q80U70
Predicted Effect possibly damaging
Transcript: ENSMUST00000017692
AA Change: D292V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017692
Gene: ENSMUSG00000017548
AA Change: D292V

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 5e-3 SMART
ZnF_C2H2 450 473 4.45e0 SMART
Pfam:VEFS-Box 548 682 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126091
SMART Domains Protein: ENSMUSP00000129070
Gene: ENSMUSG00000017548

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148140
Predicted Effect probably benign
Transcript: ENSMUST00000163272
AA Change: D269V

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126932
Gene: ENSMUSG00000017548
AA Change: D269V

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 6e-3 SMART
ZnF_C2H2 427 450 4.45e0 SMART
Pfam:VEFS-Box 523 660 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181152
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a core component of the polycomb repressive complex 2 (PRC2) that also includes, at least, embryonic ectoderm development protein (EED) and enhancer of zeste homolog 1 or 2 (EZH1 or EZH2). Through the methyltransferase activity of EZH1 or EZH2, the PRC2 complex methylates Lys9 and Lys27 of histone 3 and Lys26 of histone 1, leading to recruitment of the PRC1 complex, histone 2A ubiquitylation and transcriptional repression of the target genes. This gene product is essential for the activity and integrity of the PRC2 complex, and is required for X chromosome inactivation, stem cell maintenance and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice die during early postimplantation stages with failure of embryonic and extraembyronic tissues and organogenesis. Mice heterozygous for a knock-out allele exhibit abnormal brain and spinal cord development with varying penetrance. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(30) Chemically induced(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A T 2: 152,269,912 (GRCm39) R21S probably benign Het
Aadacl4fm1 G T 4: 144,248,912 (GRCm39) R93L probably benign Het
Adcy5 A T 16: 35,114,369 (GRCm39) T991S probably benign Het
Aldh18a1 A T 19: 40,566,214 (GRCm39) probably null Het
Anxa1 T C 19: 20,351,079 (GRCm39) *347W probably null Het
Aopep T A 13: 63,216,057 (GRCm39) I443K probably damaging Het
Arid1a G T 4: 133,408,238 (GRCm39) L2090I unknown Het
Armh3 A T 19: 45,910,136 (GRCm39) V472D possibly damaging Het
Bambi T A 18: 3,512,198 (GRCm39) L194Q probably damaging Het
Card9 A G 2: 26,246,789 (GRCm39) V353A probably damaging Het
Ccdc198 T A 14: 49,481,191 (GRCm39) I99F probably benign Het
Ccdc60 C A 5: 116,269,082 (GRCm39) probably null Het
Ccdc71 A G 9: 108,340,811 (GRCm39) K208R possibly damaging Het
Cdh12 T C 15: 21,492,743 (GRCm39) V254A probably benign Het
Cep295nl T A 11: 118,224,556 (GRCm39) N96I probably benign Het
Ces1f C A 8: 94,006,279 (GRCm39) C17F probably benign Het
Clic6 C A 16: 92,336,423 (GRCm39) T577K probably damaging Het
Col28a1 T C 6: 8,012,996 (GRCm39) M1019V probably benign Het
Ctnnd2 C A 15: 30,634,844 (GRCm39) S73Y probably damaging Het
Daam1 C T 12: 71,998,712 (GRCm39) L556F unknown Het
Dchs2 A C 3: 83,262,453 (GRCm39) N2907T probably damaging Het
Dlgap3 A C 4: 127,128,767 (GRCm39) E829A probably damaging Het
Dpysl5 A T 5: 30,935,317 (GRCm39) probably null Het
Draxin C A 4: 148,192,400 (GRCm39) C304F probably damaging Het
Eif3j1 A G 2: 121,878,005 (GRCm39) D131G possibly damaging Het
Fads1 T C 19: 10,160,551 (GRCm39) Y46H probably damaging Het
Fcgbpl1 A C 7: 27,857,017 (GRCm39) T2122P probably damaging Het
Figla T A 6: 85,995,562 (GRCm39) I72K probably damaging Het
Fnbp4 T A 2: 90,581,468 (GRCm39) S174T probably benign Het
Foxn3 C A 12: 99,162,537 (GRCm39) A455S probably benign Het
Fyn C T 10: 39,331,070 (GRCm39) probably benign Het
Gtse1 G A 15: 85,748,425 (GRCm39) G277S probably benign Het
H2bc15 T A 13: 21,938,588 (GRCm39) V99E probably benign Het
Icam4 C A 9: 20,941,078 (GRCm39) A110E probably damaging Het
Itih3 G A 14: 30,631,681 (GRCm39) S802L probably damaging Het
Kcng4 T A 8: 120,360,359 (GRCm39) R6* probably null Het
Kmt2c A T 5: 25,564,339 (GRCm39) C977S probably damaging Het
Lrrc8d A T 5: 105,960,675 (GRCm39) M362L probably benign Het
Mtus2 T C 5: 148,014,008 (GRCm39) I267T probably benign Het
Nab1 A G 1: 52,520,156 (GRCm39) V275A probably damaging Het
Nfasc G A 1: 132,498,280 (GRCm39) Q1308* probably null Het
Nop9 T C 14: 55,983,249 (GRCm39) S7P possibly damaging Het
Npbwr1 G T 1: 5,987,438 (GRCm39) N25K probably benign Het
Nptx2 T C 5: 144,490,252 (GRCm39) L227P probably damaging Het
Nrg1 T C 8: 33,373,749 (GRCm39) probably benign Het
Nup160 T A 2: 90,532,753 (GRCm39) C571* probably null Het
Nynrin T C 14: 56,107,848 (GRCm39) L985P probably damaging Het
Obsl1 A C 1: 75,479,787 (GRCm39) L341R probably damaging Het
Or1r1 T G 11: 73,875,099 (GRCm39) S112R probably damaging Het
Pate7 T A 9: 35,689,381 (GRCm39) probably benign Het
Phip G T 9: 82,795,910 (GRCm39) N570K probably damaging Het
Pigx A T 16: 31,903,341 (GRCm39) I240N probably damaging Het
Platr25 T C 13: 62,854,051 (GRCm39) D37G probably damaging Het
Ppl A T 16: 4,915,555 (GRCm39) M639K probably benign Het
Scnn1b T G 7: 121,514,551 (GRCm39) M441R probably benign Het
Sh3gl1 A T 17: 56,326,143 (GRCm39) M121K probably damaging Het
Slc30a4 A T 2: 122,531,469 (GRCm39) V132D probably damaging Het
Slc38a7 A G 8: 96,575,155 (GRCm39) S42P probably benign Het
Slc66a1 G A 4: 139,027,296 (GRCm39) L349F probably benign Het
Srp68 A G 11: 116,156,227 (GRCm39) C172R probably damaging Het
Sv2b A T 7: 74,786,048 (GRCm39) D457E possibly damaging Het
Tas2r120 T C 6: 132,634,773 (GRCm39) V285A probably benign Het
Tdo2 T A 3: 81,866,102 (GRCm39) probably benign Het
Them7 G T 2: 105,115,031 (GRCm39) probably null Het
Tnip2 T C 5: 34,660,979 (GRCm39) T158A probably damaging Het
Tonsl C T 15: 76,513,942 (GRCm39) R1209H probably benign Het
Trpc2 T A 7: 101,745,298 (GRCm39) L838* probably null Het
Trpm1 A G 7: 63,848,942 (GRCm39) I63V probably benign Het
Vps13d A T 4: 144,814,828 (GRCm39) N90K probably benign Het
Ylpm1 C T 12: 85,077,574 (GRCm39) S1433F probably damaging Het
Zbtb18 A G 1: 177,275,141 (GRCm39) D158G probably damaging Het
Zfhx2 T A 14: 55,311,795 (GRCm39) T300S probably benign Het
Zscan2 T A 7: 80,513,085 (GRCm39) D23E probably benign Het
Other mutations in Suz12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Suz12 APN 11 79,889,918 (GRCm39) missense probably damaging 0.99
IGL00938:Suz12 APN 11 79,898,395 (GRCm39) splice site probably benign
IGL01902:Suz12 APN 11 79,916,776 (GRCm39) missense probably benign 0.04
IGL02998:Suz12 APN 11 79,920,149 (GRCm39) missense probably damaging 1.00
3-1:Suz12 UTSW 11 79,889,875 (GRCm39) intron probably benign
R0317:Suz12 UTSW 11 79,889,904 (GRCm39) missense probably damaging 1.00
R0453:Suz12 UTSW 11 79,920,859 (GRCm39) missense probably damaging 1.00
R1454:Suz12 UTSW 11 79,922,939 (GRCm39) missense probably benign
R1470:Suz12 UTSW 11 79,910,558 (GRCm39) missense possibly damaging 0.87
R1470:Suz12 UTSW 11 79,910,558 (GRCm39) missense possibly damaging 0.87
R1745:Suz12 UTSW 11 79,912,922 (GRCm39) missense probably damaging 0.99
R1868:Suz12 UTSW 11 79,904,425 (GRCm39) splice site probably null
R1957:Suz12 UTSW 11 79,889,926 (GRCm39) missense probably benign 0.01
R2192:Suz12 UTSW 11 79,913,024 (GRCm39) missense probably damaging 1.00
R3003:Suz12 UTSW 11 79,910,587 (GRCm39) missense probably damaging 1.00
R3758:Suz12 UTSW 11 79,915,768 (GRCm39) missense probably benign 0.00
R4017:Suz12 UTSW 11 79,904,292 (GRCm39) missense probably damaging 1.00
R4275:Suz12 UTSW 11 79,920,879 (GRCm39) missense probably damaging 1.00
R4366:Suz12 UTSW 11 79,892,988 (GRCm39) intron probably benign
R4487:Suz12 UTSW 11 79,922,939 (GRCm39) missense probably benign
R4663:Suz12 UTSW 11 79,904,350 (GRCm39) missense probably damaging 1.00
R4730:Suz12 UTSW 11 79,892,988 (GRCm39) intron probably benign
R4959:Suz12 UTSW 11 79,920,057 (GRCm39) missense probably damaging 1.00
R5763:Suz12 UTSW 11 79,916,134 (GRCm39) nonsense probably null
R6238:Suz12 UTSW 11 79,893,006 (GRCm39) intron probably benign
R6880:Suz12 UTSW 11 79,892,998 (GRCm39) nonsense probably null
R7122:Suz12 UTSW 11 79,884,419 (GRCm39) missense probably damaging 0.99
R7195:Suz12 UTSW 11 79,904,309 (GRCm39) missense probably damaging 1.00
R7343:Suz12 UTSW 11 79,910,529 (GRCm39) missense probably benign 0.34
R7472:Suz12 UTSW 11 79,915,801 (GRCm39) missense probably benign 0.01
R8539:Suz12 UTSW 11 79,889,904 (GRCm39) missense probably damaging 1.00
R8555:Suz12 UTSW 11 79,922,817 (GRCm39) missense probably damaging 1.00
R9050:Suz12 UTSW 11 79,913,023 (GRCm39) missense probably damaging 0.99
R9263:Suz12 UTSW 11 79,904,087 (GRCm39) intron probably benign
R9632:Suz12 UTSW 11 79,915,748 (GRCm39) missense possibly damaging 0.47
R9740:Suz12 UTSW 11 79,889,920 (GRCm39) nonsense probably null
X0023:Suz12 UTSW 11 79,920,066 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTCTGTATTCAAACACTTG -3'
(R):5'- ACTATTCAGCATTGCATGTGTG -3'

Sequencing Primer
(F):5'- TTGAATTCAAGACCAGCCTGCTG -3'
(R):5'- GCATTGCATGTGTGTTTTTAAATTC -3'
Posted On 2018-05-04