Incidental Mutation 'R6379:Suz12'
ID515215
Institutional Source Beutler Lab
Gene Symbol Suz12
Ensembl Gene ENSMUSG00000017548
Gene NameSUZ12 polycomb repressive complex 2 subunit
Synonyms2610028O16Rik, D11Ertd530e
Accession Numbers

Genbank: NM_199196, NM_001163018; MGI: 1261758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location79993106-80034123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80015188 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 292 (D292V)
Ref Sequence ENSEMBL: ENSMUSP00000017692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017692] [ENSMUST00000163272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017692
AA Change: D292V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017692
Gene: ENSMUSG00000017548
AA Change: D292V

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 5e-3 SMART
ZnF_C2H2 450 473 4.45e0 SMART
Pfam:VEFS-Box 548 682 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126091
SMART Domains Protein: ENSMUSP00000129070
Gene: ENSMUSG00000017548

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148140
Predicted Effect probably benign
Transcript: ENSMUST00000163272
AA Change: D269V

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126932
Gene: ENSMUSG00000017548
AA Change: D269V

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 6e-3 SMART
ZnF_C2H2 427 450 4.45e0 SMART
Pfam:VEFS-Box 523 660 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181152
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a core component of the polycomb repressive complex 2 (PRC2) that also includes, at least, embryonic ectoderm development protein (EED) and enhancer of zeste homolog 1 or 2 (EZH1 or EZH2). Through the methyltransferase activity of EZH1 or EZH2, the PRC2 complex methylates Lys9 and Lys27 of histone 3 and Lys26 of histone 1, leading to recruitment of the PRC1 complex, histone 2A ubiquitylation and transcriptional repression of the target genes. This gene product is essential for the activity and integrity of the PRC2 complex, and is required for X chromosome inactivation, stem cell maintenance and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice die during early postimplantation stages with failure of embryonic and extraembyronic tissues and organogenesis. Mice heterozygous for a knock-out allele exhibit abnormal brain and spinal cord development with varying penetrance. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(30) Chemically induced(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Suz12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Suz12 APN 11 79999092 missense probably damaging 0.99
IGL00938:Suz12 APN 11 80007569 splice site probably benign
IGL01902:Suz12 APN 11 80025950 missense probably benign 0.04
IGL02998:Suz12 APN 11 80029323 missense probably damaging 1.00
3-1:Suz12 UTSW 11 79999049 intron probably benign
R0317:Suz12 UTSW 11 79999078 missense probably damaging 1.00
R0453:Suz12 UTSW 11 80030033 missense probably damaging 1.00
R1454:Suz12 UTSW 11 80032113 missense probably benign
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1745:Suz12 UTSW 11 80022096 missense probably damaging 0.99
R1868:Suz12 UTSW 11 80013599 splice site probably null
R1957:Suz12 UTSW 11 79999100 missense probably benign 0.01
R2192:Suz12 UTSW 11 80022198 missense probably damaging 1.00
R3003:Suz12 UTSW 11 80019761 missense probably damaging 1.00
R3758:Suz12 UTSW 11 80024942 missense probably benign 0.00
R4017:Suz12 UTSW 11 80013466 missense probably damaging 1.00
R4275:Suz12 UTSW 11 80030053 missense probably damaging 1.00
R4366:Suz12 UTSW 11 80002162 intron probably benign
R4487:Suz12 UTSW 11 80032113 missense probably benign
R4663:Suz12 UTSW 11 80013524 missense probably damaging 1.00
R4730:Suz12 UTSW 11 80002162 intron probably benign
R4959:Suz12 UTSW 11 80029231 missense probably damaging 1.00
R5763:Suz12 UTSW 11 80025308 nonsense probably null
R6238:Suz12 UTSW 11 80002180 intron probably benign
R6880:Suz12 UTSW 11 80002172 nonsense probably null
R7122:Suz12 UTSW 11 79993593 missense probably damaging 0.99
R7195:Suz12 UTSW 11 80013483 missense probably damaging 1.00
R7343:Suz12 UTSW 11 80019703 missense probably benign 0.34
R7472:Suz12 UTSW 11 80024975 missense probably benign 0.01
X0023:Suz12 UTSW 11 80029240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTCTGTATTCAAACACTTG -3'
(R):5'- ACTATTCAGCATTGCATGTGTG -3'

Sequencing Primer
(F):5'- TTGAATTCAAGACCAGCCTGCTG -3'
(R):5'- GCATTGCATGTGTGTTTTTAAATTC -3'
Posted On2018-05-04