Incidental Mutation 'R6379:Zfhx2'
ID 515226
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Name zinc finger homeobox 2
Synonyms zfh-5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock # R6379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 55060262-55092324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55074338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 300 (T300S)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
AlphaFold Q2MHN3
Predicted Effect probably benign
Transcript: ENSMUST00000036328
AA Change: T300S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: T300S

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185430
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
G1patch:Zfhx2 UTSW 14 55064082 nonsense probably null
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0148:Zfhx2 UTSW 14 55072897 missense possibly damaging 0.86
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0627:Zfhx2 UTSW 14 55065327 missense probably benign
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1301:Zfhx2 UTSW 14 55063397 missense probably benign 0.32
R1563:Zfhx2 UTSW 14 55065088 missense probably benign 0.33
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4866:Zfhx2 UTSW 14 55065536 missense possibly damaging 0.73
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5792:Zfhx2 UTSW 14 55066846 missense possibly damaging 0.72
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R8142:Zfhx2 UTSW 14 55073438 missense possibly damaging 0.86
R8188:Zfhx2 UTSW 14 55064441 missense probably benign 0.18
R8212:Zfhx2 UTSW 14 55072916 missense possibly damaging 0.70
R8264:Zfhx2 UTSW 14 55065512 missense possibly damaging 0.53
R8331:Zfhx2 UTSW 14 55071987 missense probably benign 0.00
R8369:Zfhx2 UTSW 14 55066744 missense probably benign 0.05
R8371:Zfhx2 UTSW 14 55064092 missense probably damaging 0.99
R8383:Zfhx2 UTSW 14 55074071 missense possibly damaging 0.73
R8415:Zfhx2 UTSW 14 55070622 missense probably benign
R8441:Zfhx2 UTSW 14 55066528 missense possibly damaging 0.96
R8466:Zfhx2 UTSW 14 55072896 missense possibly damaging 0.53
R8504:Zfhx2 UTSW 14 55065786 missense probably benign 0.00
R8708:Zfhx2 UTSW 14 55075052 missense probably benign
R8804:Zfhx2 UTSW 14 55074734 missense probably benign 0.18
R8913:Zfhx2 UTSW 14 55072086 missense probably benign 0.02
R8952:Zfhx2 UTSW 14 55072750 missense possibly damaging 0.86
R9057:Zfhx2 UTSW 14 55072570 missense possibly damaging 0.53
R9060:Zfhx2 UTSW 14 55074346 missense probably benign 0.00
R9197:Zfhx2 UTSW 14 55074722 nonsense probably null
R9622:Zfhx2 UTSW 14 55066026 missense probably benign 0.18
R9623:Zfhx2 UTSW 14 55064734 missense probably damaging 0.98
R9775:Zfhx2 UTSW 14 55067105 missense probably benign 0.01
R9780:Zfhx2 UTSW 14 55075037 missense probably benign 0.02
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Z1177:Zfhx2 UTSW 14 55065920 missense probably benign 0.40
Z1177:Zfhx2 UTSW 14 55066982 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GGTACTGGCGAATCTTTGGC -3'
(R):5'- ACAGGGCGATGTTTTGGATC -3'

Sequencing Primer
(F):5'- CTGGCGAATCTTTGGCTTGGG -3'
(R):5'- TTTCGGCAGGCTCCAGAC -3'
Posted On 2018-05-04