Incidental Mutation 'R6379:Nynrin'
ID515228
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55870391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 985 (L985P)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479]
Predicted Effect probably damaging
Transcript: ENSMUST00000100529
AA Change: L985P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: L985P

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168479
AA Change: L985P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: L985P

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181218
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
R7584:Nynrin UTSW 14 55871584 missense probably damaging 1.00
R7677:Nynrin UTSW 14 55870236 missense probably benign
R7723:Nynrin UTSW 14 55872045 missense possibly damaging 0.87
R7776:Nynrin UTSW 14 55865963 missense probably damaging 1.00
R7787:Nynrin UTSW 14 55870523 missense probably benign
R7842:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7852:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R8040:Nynrin UTSW 14 55871525 missense probably benign 0.01
R8159:Nynrin UTSW 14 55863130 missense probably damaging 0.99
R8159:Nynrin UTSW 14 55865060 missense probably benign
R8258:Nynrin UTSW 14 55863358 missense possibly damaging 0.95
R8259:Nynrin UTSW 14 55863358 missense possibly damaging 0.95
R8343:Nynrin UTSW 14 55863791 missense probably benign
R8504:Nynrin UTSW 14 55870246 missense probably benign 0.01
R8671:Nynrin UTSW 14 55870442 missense possibly damaging 0.52
R8691:Nynrin UTSW 14 55872649 missense probably damaging 1.00
R8777:Nynrin UTSW 14 55871663 missense probably benign
R8777-TAIL:Nynrin UTSW 14 55871663 missense probably benign
RF007:Nynrin UTSW 14 55866201 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCTGAACTGAGTGATGACGC -3'
(R):5'- AGAGATAACATCCCGGTGGG -3'

Sequencing Primer
(F):5'- ACTGAGTGATGACGCTGACGC -3'
(R):5'- GTGGGAATCCATGAAGCCC -3'
Posted On2018-05-04