Incidental Mutation 'R6379:Gtse1'
ID515232
Institutional Source Beutler Lab
Gene Symbol Gtse1
Ensembl Gene ENSMUSG00000022385
Gene NameG two S phase expressed protein 1
SynonymsB99, Gtse-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85859745-85876573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85864224 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 277 (G277S)
Ref Sequence ENSEMBL: ENSMUSP00000155552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170629] [ENSMUST00000231074]
Predicted Effect probably benign
Transcript: ENSMUST00000170629
AA Change: G277S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: G277S

DomainStartEndE-ValueType
Pfam:GTSE1_N 10 153 3e-62 PFAM
low complexity region 284 301 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
low complexity region 568 593 N/A INTRINSIC
low complexity region 644 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231074
AA Change: G277S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Sh3gl1 A T 17: 56,019,143 M121K probably damaging Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Gtse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gtse1 APN 15 85868817 missense possibly damaging 0.54
IGL01344:Gtse1 APN 15 85862066 critical splice acceptor site probably null
IGL01541:Gtse1 APN 15 85875654 nonsense probably null
IGL01621:Gtse1 APN 15 85875082 missense probably benign 0.01
IGL01945:Gtse1 APN 15 85871547 missense probably benign 0.00
IGL02193:Gtse1 APN 15 85862330 missense probably benign 0.27
IGL02215:Gtse1 APN 15 85862598 missense possibly damaging 0.92
IGL02494:Gtse1 APN 15 85867503 missense probably damaging 1.00
IGL02879:Gtse1 APN 15 85869063 splice site probably benign
R0009:Gtse1 UTSW 15 85862435 missense probably benign 0.06
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0576:Gtse1 UTSW 15 85869051 missense probably damaging 1.00
R1078:Gtse1 UTSW 15 85862307 missense probably damaging 0.98
R1442:Gtse1 UTSW 15 85860102 splice site probably benign
R1623:Gtse1 UTSW 15 85867578 missense probably benign
R1925:Gtse1 UTSW 15 85873738 missense probably benign 0.00
R1928:Gtse1 UTSW 15 85862063 splice site probably benign
R4565:Gtse1 UTSW 15 85875184 missense probably damaging 0.99
R5170:Gtse1 UTSW 15 85864264 critical splice donor site probably null
R5310:Gtse1 UTSW 15 85873792 missense probably benign 0.04
R5428:Gtse1 UTSW 15 85862139 missense probably benign 0.12
R5748:Gtse1 UTSW 15 85867577 missense probably benign
R5996:Gtse1 UTSW 15 85864180 missense probably benign 0.00
R6179:Gtse1 UTSW 15 85868957 missense possibly damaging 0.95
R6381:Gtse1 UTSW 15 85862148 missense probably benign 0.00
R6434:Gtse1 UTSW 15 85875169 missense probably benign 0.21
R7086:Gtse1 UTSW 15 85875549 missense probably damaging 1.00
R7304:Gtse1 UTSW 15 85871547 missense probably benign 0.00
R7485:Gtse1 UTSW 15 85868700 missense probably benign 0.04
R7580:Gtse1 UTSW 15 85862231 missense probably damaging 1.00
R7856:Gtse1 UTSW 15 85864141 missense probably benign 0.09
R8496:Gtse1 UTSW 15 85862082 missense probably damaging 1.00
R8674:Gtse1 UTSW 15 85862175 missense probably damaging 1.00
Z1176:Gtse1 UTSW 15 85868746 missense possibly damaging 0.85
Z1177:Gtse1 UTSW 15 85875737 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTCTGGAATTGTCAGACC -3'
(R):5'- AGTTCACTGCACATGGCCAG -3'

Sequencing Primer
(F):5'- GTCAGACCAGGTAGTCTTCAC -3'
(R):5'- TCACCAAGTTGGCTAAGCTG -3'
Posted On2018-05-04