Incidental Mutation 'R6379:Ppl'
ID 515233
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Name periplakin
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 4904155-4950285 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4915555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 639 (M639K)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035672
AA Change: M639K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: M639K

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230554
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A T 2: 152,269,912 (GRCm39) R21S probably benign Het
Aadacl4fm1 G T 4: 144,248,912 (GRCm39) R93L probably benign Het
Adcy5 A T 16: 35,114,369 (GRCm39) T991S probably benign Het
Aldh18a1 A T 19: 40,566,214 (GRCm39) probably null Het
Anxa1 T C 19: 20,351,079 (GRCm39) *347W probably null Het
Aopep T A 13: 63,216,057 (GRCm39) I443K probably damaging Het
Arid1a G T 4: 133,408,238 (GRCm39) L2090I unknown Het
Armh3 A T 19: 45,910,136 (GRCm39) V472D possibly damaging Het
Bambi T A 18: 3,512,198 (GRCm39) L194Q probably damaging Het
Card9 A G 2: 26,246,789 (GRCm39) V353A probably damaging Het
Ccdc198 T A 14: 49,481,191 (GRCm39) I99F probably benign Het
Ccdc60 C A 5: 116,269,082 (GRCm39) probably null Het
Ccdc71 A G 9: 108,340,811 (GRCm39) K208R possibly damaging Het
Cdh12 T C 15: 21,492,743 (GRCm39) V254A probably benign Het
Cep295nl T A 11: 118,224,556 (GRCm39) N96I probably benign Het
Ces1f C A 8: 94,006,279 (GRCm39) C17F probably benign Het
Clic6 C A 16: 92,336,423 (GRCm39) T577K probably damaging Het
Col28a1 T C 6: 8,012,996 (GRCm39) M1019V probably benign Het
Ctnnd2 C A 15: 30,634,844 (GRCm39) S73Y probably damaging Het
Daam1 C T 12: 71,998,712 (GRCm39) L556F unknown Het
Dchs2 A C 3: 83,262,453 (GRCm39) N2907T probably damaging Het
Dlgap3 A C 4: 127,128,767 (GRCm39) E829A probably damaging Het
Dpysl5 A T 5: 30,935,317 (GRCm39) probably null Het
Draxin C A 4: 148,192,400 (GRCm39) C304F probably damaging Het
Eif3j1 A G 2: 121,878,005 (GRCm39) D131G possibly damaging Het
Fads1 T C 19: 10,160,551 (GRCm39) Y46H probably damaging Het
Fcgbpl1 A C 7: 27,857,017 (GRCm39) T2122P probably damaging Het
Figla T A 6: 85,995,562 (GRCm39) I72K probably damaging Het
Fnbp4 T A 2: 90,581,468 (GRCm39) S174T probably benign Het
Foxn3 C A 12: 99,162,537 (GRCm39) A455S probably benign Het
Fyn C T 10: 39,331,070 (GRCm39) probably benign Het
Gtse1 G A 15: 85,748,425 (GRCm39) G277S probably benign Het
H2bc15 T A 13: 21,938,588 (GRCm39) V99E probably benign Het
Icam4 C A 9: 20,941,078 (GRCm39) A110E probably damaging Het
Itih3 G A 14: 30,631,681 (GRCm39) S802L probably damaging Het
Kcng4 T A 8: 120,360,359 (GRCm39) R6* probably null Het
Kmt2c A T 5: 25,564,339 (GRCm39) C977S probably damaging Het
Lrrc8d A T 5: 105,960,675 (GRCm39) M362L probably benign Het
Mtus2 T C 5: 148,014,008 (GRCm39) I267T probably benign Het
Nab1 A G 1: 52,520,156 (GRCm39) V275A probably damaging Het
Nfasc G A 1: 132,498,280 (GRCm39) Q1308* probably null Het
Nop9 T C 14: 55,983,249 (GRCm39) S7P possibly damaging Het
Npbwr1 G T 1: 5,987,438 (GRCm39) N25K probably benign Het
Nptx2 T C 5: 144,490,252 (GRCm39) L227P probably damaging Het
Nrg1 T C 8: 33,373,749 (GRCm39) probably benign Het
Nup160 T A 2: 90,532,753 (GRCm39) C571* probably null Het
Nynrin T C 14: 56,107,848 (GRCm39) L985P probably damaging Het
Obsl1 A C 1: 75,479,787 (GRCm39) L341R probably damaging Het
Or1r1 T G 11: 73,875,099 (GRCm39) S112R probably damaging Het
Pate7 T A 9: 35,689,381 (GRCm39) probably benign Het
Phip G T 9: 82,795,910 (GRCm39) N570K probably damaging Het
Pigx A T 16: 31,903,341 (GRCm39) I240N probably damaging Het
Platr25 T C 13: 62,854,051 (GRCm39) D37G probably damaging Het
Scnn1b T G 7: 121,514,551 (GRCm39) M441R probably benign Het
Sh3gl1 A T 17: 56,326,143 (GRCm39) M121K probably damaging Het
Slc30a4 A T 2: 122,531,469 (GRCm39) V132D probably damaging Het
Slc38a7 A G 8: 96,575,155 (GRCm39) S42P probably benign Het
Slc66a1 G A 4: 139,027,296 (GRCm39) L349F probably benign Het
Srp68 A G 11: 116,156,227 (GRCm39) C172R probably damaging Het
Suz12 A T 11: 79,906,014 (GRCm39) D292V possibly damaging Het
Sv2b A T 7: 74,786,048 (GRCm39) D457E possibly damaging Het
Tas2r120 T C 6: 132,634,773 (GRCm39) V285A probably benign Het
Tdo2 T A 3: 81,866,102 (GRCm39) probably benign Het
Them7 G T 2: 105,115,031 (GRCm39) probably null Het
Tnip2 T C 5: 34,660,979 (GRCm39) T158A probably damaging Het
Tonsl C T 15: 76,513,942 (GRCm39) R1209H probably benign Het
Trpc2 T A 7: 101,745,298 (GRCm39) L838* probably null Het
Trpm1 A G 7: 63,848,942 (GRCm39) I63V probably benign Het
Vps13d A T 4: 144,814,828 (GRCm39) N90K probably benign Het
Ylpm1 C T 12: 85,077,574 (GRCm39) S1433F probably damaging Het
Zbtb18 A G 1: 177,275,141 (GRCm39) D158G probably damaging Het
Zfhx2 T A 14: 55,311,795 (GRCm39) T300S probably benign Het
Zscan2 T A 7: 80,513,085 (GRCm39) D23E probably benign Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 4,907,409 (GRCm39) missense probably benign 0.41
IGL00484:Ppl APN 16 4,905,816 (GRCm39) missense probably benign 0.13
IGL00654:Ppl APN 16 4,905,172 (GRCm39) missense possibly damaging 0.94
IGL00832:Ppl APN 16 4,906,839 (GRCm39) missense probably damaging 1.00
IGL01104:Ppl APN 16 4,912,355 (GRCm39) missense probably benign 0.01
IGL01327:Ppl APN 16 4,905,508 (GRCm39) missense probably benign 0.19
IGL01644:Ppl APN 16 4,909,719 (GRCm39) missense probably damaging 1.00
IGL01824:Ppl APN 16 4,905,753 (GRCm39) missense probably damaging 1.00
IGL02071:Ppl APN 16 4,930,936 (GRCm39) missense probably benign 0.04
IGL02085:Ppl APN 16 4,907,680 (GRCm39) missense probably benign 0.09
IGL02282:Ppl APN 16 4,919,322 (GRCm39) missense probably damaging 1.00
IGL02635:Ppl APN 16 4,907,631 (GRCm39) missense probably benign 0.01
IGL02649:Ppl APN 16 4,905,327 (GRCm39) missense probably damaging 1.00
IGL02888:Ppl APN 16 4,918,271 (GRCm39) missense possibly damaging 0.89
IGL03305:Ppl APN 16 4,911,097 (GRCm39) missense possibly damaging 0.62
G4846:Ppl UTSW 16 4,905,070 (GRCm39) missense probably damaging 1.00
IGL03097:Ppl UTSW 16 4,914,590 (GRCm39) missense probably damaging 0.98
R0759:Ppl UTSW 16 4,907,641 (GRCm39) missense probably benign 0.00
R0786:Ppl UTSW 16 4,906,918 (GRCm39) missense probably damaging 1.00
R1024:Ppl UTSW 16 4,917,864 (GRCm39) missense probably damaging 1.00
R1498:Ppl UTSW 16 4,922,629 (GRCm39) missense probably benign 0.05
R1544:Ppl UTSW 16 4,920,461 (GRCm39) nonsense probably null
R1597:Ppl UTSW 16 4,925,438 (GRCm39) missense probably benign 0.20
R1863:Ppl UTSW 16 4,905,844 (GRCm39) missense possibly damaging 0.69
R1921:Ppl UTSW 16 4,923,988 (GRCm39) missense possibly damaging 0.80
R2230:Ppl UTSW 16 4,906,845 (GRCm39) missense possibly damaging 0.51
R2275:Ppl UTSW 16 4,912,416 (GRCm39) missense probably benign 0.00
R2355:Ppl UTSW 16 4,912,361 (GRCm39) missense probably benign 0.00
R3410:Ppl UTSW 16 4,925,381 (GRCm39) missense possibly damaging 0.81
R3737:Ppl UTSW 16 4,924,721 (GRCm39) missense probably benign
R3797:Ppl UTSW 16 4,922,414 (GRCm39) splice site probably benign
R3968:Ppl UTSW 16 4,918,196 (GRCm39) splice site probably null
R3970:Ppl UTSW 16 4,918,196 (GRCm39) splice site probably null
R4034:Ppl UTSW 16 4,924,721 (GRCm39) missense probably benign
R4583:Ppl UTSW 16 4,922,400 (GRCm39) missense probably benign 0.02
R4639:Ppl UTSW 16 4,907,310 (GRCm39) missense probably damaging 1.00
R4762:Ppl UTSW 16 4,906,846 (GRCm39) missense probably benign 0.00
R4828:Ppl UTSW 16 4,922,790 (GRCm39) missense probably damaging 1.00
R4869:Ppl UTSW 16 4,922,753 (GRCm39) missense probably damaging 0.99
R4925:Ppl UTSW 16 4,922,846 (GRCm39) missense probably damaging 1.00
R4983:Ppl UTSW 16 4,906,582 (GRCm39) missense possibly damaging 0.75
R4984:Ppl UTSW 16 4,905,505 (GRCm39) missense probably benign
R4997:Ppl UTSW 16 4,907,235 (GRCm39) missense probably damaging 1.00
R5072:Ppl UTSW 16 4,906,742 (GRCm39) missense probably benign 0.01
R5073:Ppl UTSW 16 4,906,742 (GRCm39) missense probably benign 0.01
R5074:Ppl UTSW 16 4,906,742 (GRCm39) missense probably benign 0.01
R5286:Ppl UTSW 16 4,906,987 (GRCm39) nonsense probably null
R5398:Ppl UTSW 16 4,922,786 (GRCm39) missense probably benign 0.00
R5448:Ppl UTSW 16 4,925,430 (GRCm39) missense probably benign
R5664:Ppl UTSW 16 4,923,919 (GRCm39) missense probably benign 0.00
R5873:Ppl UTSW 16 4,923,913 (GRCm39) critical splice donor site probably null
R5918:Ppl UTSW 16 4,922,765 (GRCm39) missense probably benign 0.00
R5951:Ppl UTSW 16 4,906,492 (GRCm39) missense probably benign 0.25
R6038:Ppl UTSW 16 4,920,445 (GRCm39) missense possibly damaging 0.94
R6038:Ppl UTSW 16 4,920,445 (GRCm39) missense possibly damaging 0.94
R6088:Ppl UTSW 16 4,922,852 (GRCm39) missense possibly damaging 0.73
R6149:Ppl UTSW 16 4,925,460 (GRCm39) nonsense probably null
R6358:Ppl UTSW 16 4,905,793 (GRCm39) nonsense probably null
R6468:Ppl UTSW 16 4,910,305 (GRCm39) missense probably damaging 1.00
R6514:Ppl UTSW 16 4,905,181 (GRCm39) missense probably damaging 1.00
R6528:Ppl UTSW 16 4,905,480 (GRCm39) missense probably benign 0.00
R6703:Ppl UTSW 16 4,907,328 (GRCm39) missense probably damaging 0.99
R6721:Ppl UTSW 16 4,925,333 (GRCm39) missense probably damaging 0.97
R6811:Ppl UTSW 16 4,907,008 (GRCm39) missense probably damaging 0.99
R6934:Ppl UTSW 16 4,912,373 (GRCm39) missense probably benign 0.00
R7034:Ppl UTSW 16 4,905,366 (GRCm39) missense probably benign 0.29
R7076:Ppl UTSW 16 4,917,983 (GRCm39) missense probably damaging 1.00
R7300:Ppl UTSW 16 4,920,235 (GRCm39) missense possibly damaging 0.87
R7349:Ppl UTSW 16 4,922,593 (GRCm39) missense probably damaging 0.99
R7359:Ppl UTSW 16 4,907,205 (GRCm39) missense possibly damaging 0.78
R7378:Ppl UTSW 16 4,930,860 (GRCm39) missense possibly damaging 0.91
R7383:Ppl UTSW 16 4,915,835 (GRCm39) missense probably damaging 1.00
R7389:Ppl UTSW 16 4,924,577 (GRCm39) splice site probably null
R7445:Ppl UTSW 16 4,906,932 (GRCm39) missense probably damaging 1.00
R7687:Ppl UTSW 16 4,915,806 (GRCm39) missense probably benign 0.00
R7752:Ppl UTSW 16 4,920,166 (GRCm39) missense probably benign 0.09
R7827:Ppl UTSW 16 4,905,828 (GRCm39) missense probably damaging 1.00
R7836:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7842:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7896:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7898:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7943:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R8122:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R8126:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R8284:Ppl UTSW 16 4,950,201 (GRCm39) missense probably damaging 1.00
R8680:Ppl UTSW 16 4,905,300 (GRCm39) missense probably benign 0.01
R8781:Ppl UTSW 16 4,915,800 (GRCm39) missense possibly damaging 0.68
R8835:Ppl UTSW 16 4,906,854 (GRCm39) missense probably damaging 0.99
R8836:Ppl UTSW 16 4,906,854 (GRCm39) missense probably damaging 0.99
R8837:Ppl UTSW 16 4,906,854 (GRCm39) missense probably damaging 0.99
R8866:Ppl UTSW 16 4,920,211 (GRCm39) missense probably benign 0.12
R8894:Ppl UTSW 16 4,925,206 (GRCm39) intron probably benign
R8922:Ppl UTSW 16 4,923,815 (GRCm39) missense probably benign
R8927:Ppl UTSW 16 4,905,474 (GRCm39) missense probably benign 0.19
R8928:Ppl UTSW 16 4,905,474 (GRCm39) missense probably benign 0.19
R9070:Ppl UTSW 16 4,907,208 (GRCm39) missense probably benign 0.00
R9314:Ppl UTSW 16 4,922,367 (GRCm39) missense possibly damaging 0.79
R9642:Ppl UTSW 16 4,915,602 (GRCm39) missense probably benign 0.01
RF009:Ppl UTSW 16 4,915,795 (GRCm39) missense probably benign 0.00
X0054:Ppl UTSW 16 4,922,766 (GRCm39) missense probably benign 0.00
Z1088:Ppl UTSW 16 4,907,371 (GRCm39) missense probably damaging 0.97
Z1176:Ppl UTSW 16 4,924,642 (GRCm39) missense probably damaging 0.99
Z1177:Ppl UTSW 16 4,915,821 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGCCTTTGTTTCCAGAATG -3'
(R):5'- TGAGCGACTAGTATGGTTGC -3'

Sequencing Primer
(F):5'- TTTCCAGAATGACCTGCCGG -3'
(R):5'- CGACTAGTATGGTTGCTAGAGGC -3'
Posted On 2018-05-04