Mutagenetix > Incidental Mutation

Incidental Mutation 'R6379:Ppl'

515233

Institutional Source

Beutler Lab

Gene Symbol

Ppl

Ensembl Gene

ENSMUSG00000039457

Gene Name

periplakin

Synonyms

Accession Numbers

Genbank: NM_008909

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6379 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5086291-5132421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5097691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 639 (M639K)

Ref Sequence

ENSEMBL: ENSMUSP00000039360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035672]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035672
AA Change: M639K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: M639K

Domain	Start	End	E-Value	Type
SPEC	123	211	1.58e0	SMART
SPEC	214	315	3.38e-2	SMART
SPEC	321	483	1.11e-2	SMART
SPEC	503	610	4.96e0	SMART
Blast:SPEC	613	717	5e-59	BLAST
low complexity region	718	729	N/A	INTRINSIC
Blast:SPEC	732	859	2e-60	BLAST
low complexity region	893	908	N/A	INTRINSIC
low complexity region	963	982	N/A	INTRINSIC
internal_repeat_2	984	1004	3.46e-5	PROSPERO
internal_repeat_1	992	1008	8.09e-7	PROSPERO
low complexity region	1011	1020	N/A	INTRINSIC
low complexity region	1027	1042	N/A	INTRINSIC
internal_repeat_1	1112	1128	8.09e-7	PROSPERO
coiled coil region	1180	1279	N/A	INTRINSIC
low complexity region	1346	1355	N/A	INTRINSIC
low complexity region	1386	1433	N/A	INTRINSIC
low complexity region	1455	1479	N/A	INTRINSIC
Blast:SPEC	1529	1610	8e-30	BLAST
low complexity region	1612	1630	N/A	INTRINSIC
PLEC	1649	1683	1.34e-5	SMART
PLEC	1698	1733	2.23e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230554

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	A	14: 49,243,734	I99F	probably benign	Het
2010111I01Rik	T	A	13: 63,068,243	I443K	probably damaging	Het
6820408C15Rik	A	T	2: 152,427,992	R21S	probably benign	Het
9130011E15Rik	A	T	19: 45,921,697	V472D	possibly damaging	Het
9430007A20Rik	G	T	4: 144,522,342	R93L	probably benign	Het
9530053A07Rik	A	C	7: 28,157,592	T2122P	probably damaging	Het
Adcy5	A	T	16: 35,293,999	T991S	probably benign	Het
Aldh18a1	A	T	19: 40,577,770		probably null	Het
Anxa1	T	C	19: 20,373,715	*347W	probably null	Het
Arid1a	G	T	4: 133,680,927	L2090I	unknown	Het
Bambi	T	A	18: 3,512,198	L194Q	probably damaging	Het
Card9	A	G	2: 26,356,777	V353A	probably damaging	Het
Ccdc60	C	A	5: 116,131,023		probably null	Het
Ccdc71	A	G	9: 108,463,612	K208R	possibly damaging	Het
Cdh12	T	C	15: 21,492,657	V254A	probably benign	Het
Cep295nl	T	A	11: 118,333,730	N96I	probably benign	Het
Ces1f	C	A	8: 93,279,651	C17F	probably benign	Het
Clic6	C	A	16: 92,539,535	T577K	probably damaging	Het
Col28a1	T	C	6: 8,012,996	M1019V	probably benign	Het
Ctnnd2	C	A	15: 30,634,698	S73Y	probably damaging	Het
Daam1	C	T	12: 71,951,938	L556F	unknown	Het
Dchs2	A	C	3: 83,355,146	N2907T	probably damaging	Het
Dlgap3	A	C	4: 127,234,974	E829A	probably damaging	Het
Dpysl5	A	T	5: 30,777,973		probably null	Het
Draxin	C	A	4: 148,107,943	C304F	probably damaging	Het
Eif3j1	A	G	2: 122,047,524	D131G	possibly damaging	Het
Fads1	T	C	19: 10,183,187	Y46H	probably damaging	Het
Figla	T	A	6: 86,018,580	I72K	probably damaging	Het
Fnbp4	T	A	2: 90,751,124	S174T	probably benign	Het
Foxn3	C	A	12: 99,196,278	A455S	probably benign	Het
Fyn	C	T	10: 39,455,074		probably benign	Het
Gm17727	T	A	9: 35,778,085		probably benign	Het
Gtse1	G	A	15: 85,864,224	G277S	probably benign	Het
Hist1h2bn	T	A	13: 21,754,418	V99E	probably benign	Het
Icam4	C	A	9: 21,029,782	A110E	probably damaging	Het
Itih3	G	A	14: 30,909,724	S802L	probably damaging	Het
Kcng4	T	A	8: 119,633,620	R6*	probably null	Het
Kmt2c	A	T	5: 25,359,341	C977S	probably damaging	Het
Lrrc8d	A	T	5: 105,812,809	M362L	probably benign	Het
Mtus2	T	C	5: 148,077,198	I267T	probably benign	Het
Nab1	A	G	1: 52,480,997	V275A	probably damaging	Het
Nfasc	G	A	1: 132,570,542	Q1308*	probably null	Het
Nop9	T	C	14: 55,745,792	S7P	possibly damaging	Het
Npbwr1	G	T	1: 5,917,219	N25K	probably benign	Het
Nptx2	T	C	5: 144,553,442	L227P	probably damaging	Het
Nrg1	T	C	8: 32,883,721		probably benign	Het
Nup160	T	A	2: 90,702,409	C571*	probably null	Het
Nynrin	T	C	14: 55,870,391	L985P	probably damaging	Het
Obsl1	A	C	1: 75,503,143	L341R	probably damaging	Het
Olfr398	T	G	11: 73,984,273	S112R	probably damaging	Het
Phip	G	T	9: 82,913,857	N570K	probably damaging	Het
Pigx	A	T	16: 32,084,523	I240N	probably damaging	Het
Platr25	T	C	13: 62,706,237	D37G	probably damaging	Het
Pqlc2	G	A	4: 139,299,985	L349F	probably benign	Het
Scnn1b	T	G	7: 121,915,328	M441R	probably benign	Het
Sh3gl1	A	T	17: 56,019,143	M121K	probably damaging	Het
Slc30a4	A	T	2: 122,689,549	V132D	probably damaging	Het
Slc38a7	A	G	8: 95,848,527	S42P	probably benign	Het
Srp68	A	G	11: 116,265,401	C172R	probably damaging	Het
Suz12	A	T	11: 80,015,188	D292V	possibly damaging	Het
Sv2b	A	T	7: 75,136,300	D457E	possibly damaging	Het
Tas2r120	T	C	6: 132,657,810	V285A	probably benign	Het
Tdo2	T	A	3: 81,958,795		probably benign	Het
Them7	G	T	2: 105,284,686		probably null	Het
Tnip2	T	C	5: 34,503,635	T158A	probably damaging	Het
Tonsl	C	T	15: 76,629,742	R1209H	probably benign	Het
Trpc2	T	A	7: 102,096,091	L838*	probably null	Het
Trpm1	A	G	7: 64,199,194	I63V	probably benign	Het
Vps13d	A	T	4: 145,088,258	N90K	probably benign	Het
Ylpm1	C	T	12: 85,030,800	S1433F	probably damaging	Het
Zbtb18	A	G	1: 177,447,575	D158G	probably damaging	Het
Zfhx2	T	A	14: 55,074,338	T300S	probably benign	Het
Zscan2	T	A	7: 80,863,337	D23E	probably benign	Het

Other mutations in Ppl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ppl	APN	16	5089545	missense	probably benign	0.41
IGL00484:Ppl	APN	16	5087952	missense	probably benign	0.13
IGL00654:Ppl	APN	16	5087308	missense	possibly damaging	0.94
IGL00832:Ppl	APN	16	5088975	missense	probably damaging	1.00
IGL01104:Ppl	APN	16	5094491	missense	probably benign	0.01
IGL01327:Ppl	APN	16	5087644	missense	probably benign	0.19
IGL01644:Ppl	APN	16	5091855	missense	probably damaging	1.00
IGL01824:Ppl	APN	16	5087889	missense	probably damaging	1.00
IGL02071:Ppl	APN	16	5113072	missense	probably benign	0.04
IGL02085:Ppl	APN	16	5089816	missense	probably benign	0.09
IGL02282:Ppl	APN	16	5101458	missense	probably damaging	1.00
IGL02635:Ppl	APN	16	5089767	missense	probably benign	0.01
IGL02649:Ppl	APN	16	5087463	missense	probably damaging	1.00
IGL02888:Ppl	APN	16	5100407	missense	possibly damaging	0.89
IGL03305:Ppl	APN	16	5093233	missense	possibly damaging	0.62
G4846:Ppl	UTSW	16	5087206	missense	probably damaging	1.00
IGL03097:Ppl	UTSW	16	5096726	missense	probably damaging	0.98
R0759:Ppl	UTSW	16	5089777	missense	probably benign	0.00
R0786:Ppl	UTSW	16	5089054	missense	probably damaging	1.00
R1024:Ppl	UTSW	16	5100000	missense	probably damaging	1.00
R1498:Ppl	UTSW	16	5104765	missense	probably benign	0.05
R1544:Ppl	UTSW	16	5102597	nonsense	probably null
R1597:Ppl	UTSW	16	5107574	missense	probably benign	0.20
R1863:Ppl	UTSW	16	5087980	missense	possibly damaging	0.69
R1921:Ppl	UTSW	16	5106124	missense	possibly damaging	0.80
R2230:Ppl	UTSW	16	5088981	missense	possibly damaging	0.51
R2275:Ppl	UTSW	16	5094552	missense	probably benign	0.00
R2355:Ppl	UTSW	16	5094497	missense	probably benign	0.00
R3410:Ppl	UTSW	16	5107517	missense	possibly damaging	0.81
R3737:Ppl	UTSW	16	5106857	missense	probably benign
R3797:Ppl	UTSW	16	5104550	splice site	probably benign
R3968:Ppl	UTSW	16	5100332	splice site	probably null
R3970:Ppl	UTSW	16	5100332	splice site	probably null
R4034:Ppl	UTSW	16	5106857	missense	probably benign
R4583:Ppl	UTSW	16	5104536	missense	probably benign	0.02
R4639:Ppl	UTSW	16	5089446	missense	probably damaging	1.00
R4762:Ppl	UTSW	16	5088982	missense	probably benign	0.00
R4828:Ppl	UTSW	16	5104926	missense	probably damaging	1.00
R4869:Ppl	UTSW	16	5104889	missense	probably damaging	0.99
R4925:Ppl	UTSW	16	5104982	missense	probably damaging	1.00
R4983:Ppl	UTSW	16	5088718	missense	possibly damaging	0.75
R4984:Ppl	UTSW	16	5087641	missense	probably benign
R4997:Ppl	UTSW	16	5089371	missense	probably damaging	1.00
R5072:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5073:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5074:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5286:Ppl	UTSW	16	5089123	nonsense	probably null
R5398:Ppl	UTSW	16	5104922	missense	probably benign	0.00
R5448:Ppl	UTSW	16	5107566	missense	probably benign
R5664:Ppl	UTSW	16	5106055	missense	probably benign	0.00
R5873:Ppl	UTSW	16	5106049	critical splice donor site	probably null
R5918:Ppl	UTSW	16	5104901	missense	probably benign	0.00
R5951:Ppl	UTSW	16	5088628	missense	probably benign	0.25
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6088:Ppl	UTSW	16	5104988	missense	possibly damaging	0.73
R6149:Ppl	UTSW	16	5107596	nonsense	probably null
R6358:Ppl	UTSW	16	5087929	nonsense	probably null
R6468:Ppl	UTSW	16	5092441	missense	probably damaging	1.00
R6514:Ppl	UTSW	16	5087317	missense	probably damaging	1.00
R6528:Ppl	UTSW	16	5087616	missense	probably benign	0.00
R6703:Ppl	UTSW	16	5089464	missense	probably damaging	0.99
R6721:Ppl	UTSW	16	5107469	missense	probably damaging	0.97
R6811:Ppl	UTSW	16	5089144	missense	probably damaging	0.99
R6934:Ppl	UTSW	16	5094509	missense	probably benign	0.00
R7034:Ppl	UTSW	16	5087502	missense	probably benign	0.29
R7076:Ppl	UTSW	16	5100119	missense	probably damaging	1.00
R7300:Ppl	UTSW	16	5102371	missense	possibly damaging	0.87
R7349:Ppl	UTSW	16	5104729	missense	probably damaging	0.99
R7359:Ppl	UTSW	16	5089341	missense	possibly damaging	0.78
R7378:Ppl	UTSW	16	5112996	missense	possibly damaging	0.91
R7383:Ppl	UTSW	16	5097971	missense	probably damaging	1.00
R7389:Ppl	UTSW	16	5106713	splice site	probably null
R7445:Ppl	UTSW	16	5089068	missense	probably damaging	1.00
R7687:Ppl	UTSW	16	5097942	missense	probably benign	0.00
R7752:Ppl	UTSW	16	5102302	missense	probably benign	0.09
R7827:Ppl	UTSW	16	5087964	missense	probably damaging	1.00
R7836:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7842:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7896:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7898:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7943:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8122:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8126:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8284:Ppl	UTSW	16	5132337	missense	probably damaging	1.00
R8680:Ppl	UTSW	16	5087436	missense	probably benign	0.01
R8781:Ppl	UTSW	16	5097936	missense	possibly damaging	0.68
R8835:Ppl	UTSW	16	5088990	missense	probably damaging	0.99
R8836:Ppl	UTSW	16	5088990	missense	probably damaging	0.99
R8837:Ppl	UTSW	16	5088990	missense	probably damaging	0.99
R8866:Ppl	UTSW	16	5102347	missense	probably benign	0.12
R8894:Ppl	UTSW	16	5107342	intron	probably benign
R8922:Ppl	UTSW	16	5105951	missense	probably benign
R8927:Ppl	UTSW	16	5087610	missense	probably benign	0.19
R8928:Ppl	UTSW	16	5087610	missense	probably benign	0.19
R9070:Ppl	UTSW	16	5089344	missense	probably benign	0.00
R9314:Ppl	UTSW	16	5104503	missense	possibly damaging	0.79
R9642:Ppl	UTSW	16	5097738	missense	probably benign	0.01
RF009:Ppl	UTSW	16	5097931	missense	probably benign	0.00
X0054:Ppl	UTSW	16	5104902	missense	probably benign	0.00
Z1088:Ppl	UTSW	16	5089507	missense	probably damaging	0.97
Z1176:Ppl	UTSW	16	5106778	missense	probably damaging	0.99
Z1177:Ppl	UTSW	16	5097957	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACTGCCTTTGTTTCCAGAATG -3'
(R):5'- TGAGCGACTAGTATGGTTGC -3'

Sequencing Primer
(F):5'- TTTCCAGAATGACCTGCCGG -3'
(R):5'- CGACTAGTATGGTTGCTAGAGGC -3'

Posted On

2018-05-04