Incidental Mutation 'R6379:Sh3gl1'
ID515237
Institutional Source Beutler Lab
Gene Symbol Sh3gl1
Ensembl Gene ENSMUSG00000003200
Gene NameSH3-domain GRB2-like 1
SynonymsSh3d2b, SH3P8, endophilin II, EEN
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6379 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56016753-56036637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56019143 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 121 (M121K)
Ref Sequence ENSEMBL: ENSMUSP00000003268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003268] [ENSMUST00000149441] [ENSMUST00000159996] [ENSMUST00000162883]
Predicted Effect probably damaging
Transcript: ENSMUST00000003268
AA Change: M121K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003268
Gene: ENSMUSG00000003200
AA Change: M121K

DomainStartEndE-ValueType
BAR 5 242 1.05e-98 SMART
low complexity region 250 264 N/A INTRINSIC
SH3 309 364 7.62e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131218
Predicted Effect probably benign
Transcript: ENSMUST00000149441
SMART Domains Protein: ENSMUSP00000119745
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153197
SMART Domains Protein: ENSMUSP00000125535
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Pfam:JAB 112 243 6.1e-11 PFAM
Pfam:Prok-JAB 125 258 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159340
SMART Domains Protein: ENSMUSP00000125555
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 29 68 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
Blast:JAB_MPN 257 350 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159420
Predicted Effect probably benign
Transcript: ENSMUST00000159996
SMART Domains Protein: ENSMUSP00000124644
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162883
SMART Domains Protein: ENSMUSP00000124128
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
Pfam:Prok-JAB 230 340 1.6e-8 PFAM
Pfam:JAB 236 311 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal life span and no obvious phenotypic defects. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmissionand abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,243,734 I99F probably benign Het
2010111I01Rik T A 13: 63,068,243 I443K probably damaging Het
6820408C15Rik A T 2: 152,427,992 R21S probably benign Het
9130011E15Rik A T 19: 45,921,697 V472D possibly damaging Het
9430007A20Rik G T 4: 144,522,342 R93L probably benign Het
9530053A07Rik A C 7: 28,157,592 T2122P probably damaging Het
Adcy5 A T 16: 35,293,999 T991S probably benign Het
Aldh18a1 A T 19: 40,577,770 probably null Het
Anxa1 T C 19: 20,373,715 *347W probably null Het
Arid1a G T 4: 133,680,927 L2090I unknown Het
Bambi T A 18: 3,512,198 L194Q probably damaging Het
Card9 A G 2: 26,356,777 V353A probably damaging Het
Ccdc60 C A 5: 116,131,023 probably null Het
Ccdc71 A G 9: 108,463,612 K208R possibly damaging Het
Cdh12 T C 15: 21,492,657 V254A probably benign Het
Cep295nl T A 11: 118,333,730 N96I probably benign Het
Ces1f C A 8: 93,279,651 C17F probably benign Het
Clic6 C A 16: 92,539,535 T577K probably damaging Het
Col28a1 T C 6: 8,012,996 M1019V probably benign Het
Ctnnd2 C A 15: 30,634,698 S73Y probably damaging Het
Daam1 C T 12: 71,951,938 L556F unknown Het
Dchs2 A C 3: 83,355,146 N2907T probably damaging Het
Dlgap3 A C 4: 127,234,974 E829A probably damaging Het
Dpysl5 A T 5: 30,777,973 probably null Het
Draxin C A 4: 148,107,943 C304F probably damaging Het
Eif3j1 A G 2: 122,047,524 D131G possibly damaging Het
Fads1 T C 19: 10,183,187 Y46H probably damaging Het
Figla T A 6: 86,018,580 I72K probably damaging Het
Fnbp4 T A 2: 90,751,124 S174T probably benign Het
Foxn3 C A 12: 99,196,278 A455S probably benign Het
Fyn C T 10: 39,455,074 probably benign Het
Gm17727 T A 9: 35,778,085 probably benign Het
Gtse1 G A 15: 85,864,224 G277S probably benign Het
Hist1h2bn T A 13: 21,754,418 V99E probably benign Het
Icam4 C A 9: 21,029,782 A110E probably damaging Het
Itih3 G A 14: 30,909,724 S802L probably damaging Het
Kcng4 T A 8: 119,633,620 R6* probably null Het
Kmt2c A T 5: 25,359,341 C977S probably damaging Het
Lrrc8d A T 5: 105,812,809 M362L probably benign Het
Mtus2 T C 5: 148,077,198 I267T probably benign Het
Nab1 A G 1: 52,480,997 V275A probably damaging Het
Nfasc G A 1: 132,570,542 Q1308* probably null Het
Nop9 T C 14: 55,745,792 S7P possibly damaging Het
Npbwr1 G T 1: 5,917,219 N25K probably benign Het
Nptx2 T C 5: 144,553,442 L227P probably damaging Het
Nrg1 T C 8: 32,883,721 probably benign Het
Nup160 T A 2: 90,702,409 C571* probably null Het
Nynrin T C 14: 55,870,391 L985P probably damaging Het
Obsl1 A C 1: 75,503,143 L341R probably damaging Het
Olfr398 T G 11: 73,984,273 S112R probably damaging Het
Phip G T 9: 82,913,857 N570K probably damaging Het
Pigx A T 16: 32,084,523 I240N probably damaging Het
Platr25 T C 13: 62,706,237 D37G probably damaging Het
Ppl A T 16: 5,097,691 M639K probably benign Het
Pqlc2 G A 4: 139,299,985 L349F probably benign Het
Scnn1b T G 7: 121,915,328 M441R probably benign Het
Slc30a4 A T 2: 122,689,549 V132D probably damaging Het
Slc38a7 A G 8: 95,848,527 S42P probably benign Het
Srp68 A G 11: 116,265,401 C172R probably damaging Het
Suz12 A T 11: 80,015,188 D292V possibly damaging Het
Sv2b A T 7: 75,136,300 D457E possibly damaging Het
Tas2r120 T C 6: 132,657,810 V285A probably benign Het
Tdo2 T A 3: 81,958,795 probably benign Het
Them7 G T 2: 105,284,686 probably null Het
Tnip2 T C 5: 34,503,635 T158A probably damaging Het
Tonsl C T 15: 76,629,742 R1209H probably benign Het
Trpc2 T A 7: 102,096,091 L838* probably null Het
Trpm1 A G 7: 64,199,194 I63V probably benign Het
Vps13d A T 4: 145,088,258 N90K probably benign Het
Ylpm1 C T 12: 85,030,800 S1433F probably damaging Het
Zbtb18 A G 1: 177,447,575 D158G probably damaging Het
Zfhx2 T A 14: 55,074,338 T300S probably benign Het
Zscan2 T A 7: 80,863,337 D23E probably benign Het
Other mutations in Sh3gl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Sh3gl1 APN 17 56019325 missense possibly damaging 0.48
IGL02721:Sh3gl1 APN 17 56017577 missense possibly damaging 0.91
feroce UTSW 17 56017617 missense possibly damaging 0.84
sauvage UTSW 17 56019038 critical splice donor site probably null
R0092:Sh3gl1 UTSW 17 56018088 missense probably benign 0.00
R0525:Sh3gl1 UTSW 17 56017873 missense probably benign 0.00
R3684:Sh3gl1 UTSW 17 56018953 missense possibly damaging 0.91
R3792:Sh3gl1 UTSW 17 56018949 missense probably damaging 1.00
R4282:Sh3gl1 UTSW 17 56036456 missense probably damaging 1.00
R4298:Sh3gl1 UTSW 17 56019173 missense probably damaging 1.00
R5868:Sh3gl1 UTSW 17 56019119 missense probably damaging 1.00
R6304:Sh3gl1 UTSW 17 56036431 missense probably benign 0.01
R6523:Sh3gl1 UTSW 17 56017617 missense possibly damaging 0.84
R7146:Sh3gl1 UTSW 17 56017646 missense probably damaging 1.00
R7174:Sh3gl1 UTSW 17 56017846 missense probably benign 0.01
R7922:Sh3gl1 UTSW 17 56019438 missense probably damaging 1.00
R8248:Sh3gl1 UTSW 17 56019038 critical splice donor site probably null
R8429:Sh3gl1 UTSW 17 56018821 missense possibly damaging 0.94
R8460:Sh3gl1 UTSW 17 56019321 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAATTTCTTCAGGTGGTGC -3'
(R):5'- TCGCCATGGCAAGGAACTAG -3'

Sequencing Primer
(F):5'- TGCTGTGGGTGCAGACAC -3'
(R):5'- AGTCCAACTTCGGTGAGGG -3'
Posted On2018-05-04