Incidental Mutation 'R6380:Aco1'
ID515254
Institutional Source Beutler Lab
Gene Symbol Aco1
Ensembl Gene ENSMUSG00000028405
Gene Nameaconitase 1
SynonymsIrp1, Irebp, Aco-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location40143081-40198338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40185028 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 566 (V566A)
Ref Sequence ENSEMBL: ENSMUSP00000100038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102973]
Predicted Effect probably benign
Transcript: ENSMUST00000102973
AA Change: V566A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000100038
Gene: ENSMUSG00000028405
AA Change: V566A

DomainStartEndE-ValueType
Pfam:Aconitase 54 564 4.5e-180 PFAM
Pfam:Aconitase_C 692 821 1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the aconitase/IPM isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Depending on iron levels in the cytosol, the encoded protein can function as either an aconitase enzyme or as an mRNA binding protein. When cellular iron levels are high, the encoded protein functions as an aconitase, an essential enzyme in the TCA cycle that catalyzes the conversion of citrate to isocitrate. When cellular iron levels are low, the encoded protein regulates iron uptake and utilization by binding to iron-responsive elements in the untranslated regions of mRNAs for genes involved in iron metabolism. Disruption of this gene is associated with pulmonary hypertension and polycythemia. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Aco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Aco1 APN 4 40180290 critical splice donor site probably null
IGL01081:Aco1 APN 4 40197576 missense probably benign
IGL01364:Aco1 APN 4 40181380 splice site probably null
IGL01733:Aco1 APN 4 40175738 splice site probably benign
IGL02232:Aco1 APN 4 40175996 missense probably damaging 1.00
IGL02709:Aco1 APN 4 40180199 missense possibly damaging 0.86
IGL03164:Aco1 APN 4 40167116 missense probably benign 0.30
IGL03208:Aco1 APN 4 40186424 missense possibly damaging 0.55
IGL03324:Aco1 APN 4 40186363 missense probably benign
IGL03353:Aco1 APN 4 40175893 missense probably damaging 0.99
R0002:Aco1 UTSW 4 40176649 splice site probably benign
R0486:Aco1 UTSW 4 40177783 missense probably damaging 1.00
R0636:Aco1 UTSW 4 40175697 missense probably damaging 1.00
R1344:Aco1 UTSW 4 40179008 missense probably damaging 1.00
R1844:Aco1 UTSW 4 40197566 missense probably benign 0.00
R1889:Aco1 UTSW 4 40164607 critical splice acceptor site probably null
R1932:Aco1 UTSW 4 40176499 missense probably damaging 1.00
R1959:Aco1 UTSW 4 40167193 critical splice donor site probably null
R1965:Aco1 UTSW 4 40175730 missense probably damaging 1.00
R1983:Aco1 UTSW 4 40175845 missense probably benign 0.37
R2072:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2073:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2074:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R3155:Aco1 UTSW 4 40182915 missense probably damaging 1.00
R4595:Aco1 UTSW 4 40167139 missense probably benign 0.43
R4999:Aco1 UTSW 4 40176507 missense probably damaging 1.00
R5131:Aco1 UTSW 4 40163797 missense probably benign
R5354:Aco1 UTSW 4 40180290 critical splice donor site probably null
R5380:Aco1 UTSW 4 40177848 missense probably damaging 1.00
R6352:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6353:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6540:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6751:Aco1 UTSW 4 40188330 intron probably null
R6760:Aco1 UTSW 4 40180210 nonsense probably null
R6833:Aco1 UTSW 4 40164747 missense probably benign 0.00
R6834:Aco1 UTSW 4 40164747 missense probably benign 0.00
R7019:Aco1 UTSW 4 40186376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACCTGACAGAAGCCTAG -3'
(R):5'- TTGGCTGTACCCAGAAGAACAG -3'

Sequencing Primer
(F):5'- GGCAGTGCCTTCCTTGTGAAC -3'
(R):5'- CTGTACCCAGAAGAACAGTGAAG -3'
Posted On2018-05-04