Incidental Mutation 'R6380:Whrn'
ID515255
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Namewhirlin
SynonymsC430046P22Rik, Dfnb31, wi, 1110035G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63414910-63495991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63418592 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 136 (P136T)
Ref Sequence ENSEMBL: ENSMUSP00000114030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063650
AA Change: P578T

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: P578T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084510
AA Change: P589T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: P589T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095037
AA Change: P75T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137
AA Change: P75T

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
AA Change: P147T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137
AA Change: P147T

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102867
AA Change: P578T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: P578T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107393
AA Change: P582T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: P582T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119294
AA Change: P136T

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137
AA Change: P136T

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R0631:Whrn UTSW 4 63419489 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5207:Whrn UTSW 4 63432714 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5307:Whrn UTSW 4 63431843 missense probably benign 0.01
R5463:Whrn UTSW 4 63432816 missense probably benign 0.08
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6212:Whrn UTSW 4 63494686 nonsense probably null
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGTCCTGTGCTGAGGAAG -3'
(R):5'- CTAAGGAATCGAGTGGGTCC -3'

Sequencing Primer
(F):5'- TGTGCTGAGGAAGGTCCC -3'
(R):5'- CTGAGATGCAGGGAACAGTTTTC -3'
Posted On2018-05-04