Mutagenetix > Incidental Mutations

Incidental Mutation 'R6380:Lepr'

515257

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6380 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 101764954 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 361 (S361*)

Ref Sequence

ENSEMBL: ENSMUSP00000102534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]

Predicted Effect

probably null
Transcript: ENSMUST00000037552
AA Change: S361*

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: S361*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102777
AA Change: S361*

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: S361*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106921
AA Change: S361*

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: S361*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128948

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.5%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	G	A	1: 93,160,891		probably null	Het
4930590J08Rik	G	A	6: 91,923,137	G424D	probably damaging	Het
4932438A13Rik	A	G	3: 37,033,307	D4019G	probably benign	Het
Aco1	T	C	4: 40,185,028	V566A	probably benign	Het
Adat1	G	T	8: 111,978,072	T414K	probably benign	Het
Alox12e	A	G	11: 70,321,101	V194A	probably benign	Het
Anpep	A	G	7: 79,841,896	V119A	probably benign	Het
Atat1	C	A	17: 35,908,957		probably null	Het
Atp10a	G	A	7: 58,819,684	W1094*	probably null	Het
Bcl11b	T	C	12: 108,003,101	R15G	probably benign	Het
Btnl1	A	G	17: 34,379,494	E28G	probably benign	Het
Ccnd1	A	G	7: 144,939,569	V42A	probably benign	Het
Cdyl2	T	A	8: 116,583,184	K344N	probably damaging	Het
Cep68	A	G	11: 20,230,498	M711T	probably benign	Het
Cyp2j7	A	G	4: 96,229,974		probably null	Het
Cyp3a25	A	T	5: 145,998,547	D86E	probably damaging	Het
Dclk1	G	T	3: 55,247,194	R15L	probably damaging	Het
Dpy19l1	T	A	9: 24,482,045	K143*	probably null	Het
Duox2	A	G	2: 122,281,002	V1405A	probably benign	Het
Filip1	T	C	9: 79,819,624	E571G	probably damaging	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Jph1	T	C	1: 17,091,847	N197S	probably damaging	Het
Kcnt2	T	C	1: 140,509,584	L535S	probably damaging	Het
Lfng	T	A	5: 140,614,396		probably null	Het
Lpcat2	G	A	8: 92,886,581	A250T	probably benign	Het
Map3k4	A	T	17: 12,272,067	M159K	possibly damaging	Het
Notch3	A	T	17: 32,144,559	C1177S	probably damaging	Het
Olfml2b	C	T	1: 170,669,231	P477L	probably benign	Het
Olfr180	T	A	16: 58,916,264	I126L	probably damaging	Het
Olfr586	A	T	7: 103,121,929	F281Y	probably benign	Het
Olfr820	A	T	10: 130,017,913	H184L	probably benign	Het
Pald1	G	T	10: 61,350,935	F146L	possibly damaging	Het
Pcdhga1	A	G	18: 37,662,969	D342G	probably damaging	Het
Plcb2	T	C	2: 118,715,468	S579G	probably damaging	Het
Prdm16	A	T	4: 154,341,367	S654T	probably benign	Het
Rab3gap2	C	A	1: 185,235,984	L178I	probably damaging	Het
Rbfox1	C	T	16: 7,224,350	Q23*	probably null	Het
Slc14a2	T	G	18: 78,146,975	T920P	probably benign	Het
Slc17a6	G	A	7: 51,667,463	V411M	probably benign	Het
Stard6	G	A	18: 70,476,388	V33I	probably benign	Het
Syce1	A	T	7: 140,779,065	H178Q	probably damaging	Het
Syne2	T	A	12: 76,104,980	F1872I	probably damaging	Het
Tor1aip1	T	C	1: 156,018,488	E274G	possibly damaging	Het
Trpm1	A	T	7: 64,268,297	T462S	probably benign	Het
Ugt3a1	C	T	15: 9,306,455	A230V	probably benign	Het
Vmn1r178	A	G	7: 23,893,559	T11A	possibly damaging	Het
Vmn2r69	A	T	7: 85,411,859	N172K	probably benign	Het
Whrn	G	T	4: 63,418,592	P136T	possibly damaging	Het
Zfhx4	A	G	3: 5,413,110	N3570S	probably damaging	Het
Zfp689	A	G	7: 127,444,796	S221P	probably damaging	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
R8682:Lepr	UTSW	4	101792072	missense	probably benign	0.00
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCATTTGATTTTGGCAGG -3'
(R):5'- CGTATAATTCAGCATAGCGGTG -3'

Sequencing Primer
(F):5'- AGGACGTGGCAATCTCTTTC -3'
(R):5'- TCAGCATAGCGGTGATGGC -3'

Posted On

2018-05-04