Mutagenetix > Incidental Mutations

Incidental Mutation 'R6380:Atp10a'

515264

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R6380 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 58819684 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 1094 (W1094*)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably null
Transcript: ENSMUST00000168747
AA Change: W1094*

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: W1094*

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.5%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	G	A	1: 93,160,891		probably null	Het
4930590J08Rik	G	A	6: 91,923,137	G424D	probably damaging	Het
4932438A13Rik	A	G	3: 37,033,307	D4019G	probably benign	Het
Aco1	T	C	4: 40,185,028	V566A	probably benign	Het
Adat1	G	T	8: 111,978,072	T414K	probably benign	Het
Alox12e	A	G	11: 70,321,101	V194A	probably benign	Het
Anpep	A	G	7: 79,841,896	V119A	probably benign	Het
Atat1	C	A	17: 35,908,957		probably null	Het
Bcl11b	T	C	12: 108,003,101	R15G	probably benign	Het
Btnl1	A	G	17: 34,379,494	E28G	probably benign	Het
Ccnd1	A	G	7: 144,939,569	V42A	probably benign	Het
Cdyl2	T	A	8: 116,583,184	K344N	probably damaging	Het
Cep68	A	G	11: 20,230,498	M711T	probably benign	Het
Cyp2j7	A	G	4: 96,229,974		probably null	Het
Cyp3a25	A	T	5: 145,998,547	D86E	probably damaging	Het
Dclk1	G	T	3: 55,247,194	R15L	probably damaging	Het
Dpy19l1	T	A	9: 24,482,045	K143*	probably null	Het
Duox2	A	G	2: 122,281,002	V1405A	probably benign	Het
Filip1	T	C	9: 79,819,624	E571G	probably damaging	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Jph1	T	C	1: 17,091,847	N197S	probably damaging	Het
Kcnt2	T	C	1: 140,509,584	L535S	probably damaging	Het
Lepr	C	A	4: 101,764,954	S361*	probably null	Het
Lfng	T	A	5: 140,614,396		probably null	Het
Lpcat2	G	A	8: 92,886,581	A250T	probably benign	Het
Map3k4	A	T	17: 12,272,067	M159K	possibly damaging	Het
Notch3	A	T	17: 32,144,559	C1177S	probably damaging	Het
Olfml2b	C	T	1: 170,669,231	P477L	probably benign	Het
Olfr180	T	A	16: 58,916,264	I126L	probably damaging	Het
Olfr586	A	T	7: 103,121,929	F281Y	probably benign	Het
Olfr820	A	T	10: 130,017,913	H184L	probably benign	Het
Pald1	G	T	10: 61,350,935	F146L	possibly damaging	Het
Pcdhga1	A	G	18: 37,662,969	D342G	probably damaging	Het
Plcb2	T	C	2: 118,715,468	S579G	probably damaging	Het
Prdm16	A	T	4: 154,341,367	S654T	probably benign	Het
Rab3gap2	C	A	1: 185,235,984	L178I	probably damaging	Het
Rbfox1	C	T	16: 7,224,350	Q23*	probably null	Het
Slc14a2	T	G	18: 78,146,975	T920P	probably benign	Het
Slc17a6	G	A	7: 51,667,463	V411M	probably benign	Het
Stard6	G	A	18: 70,476,388	V33I	probably benign	Het
Syce1	A	T	7: 140,779,065	H178Q	probably damaging	Het
Syne2	T	A	12: 76,104,980	F1872I	probably damaging	Het
Tor1aip1	T	C	1: 156,018,488	E274G	possibly damaging	Het
Trpm1	A	T	7: 64,268,297	T462S	probably benign	Het
Ugt3a1	C	T	15: 9,306,455	A230V	probably benign	Het
Vmn1r178	A	G	7: 23,893,559	T11A	possibly damaging	Het
Vmn2r69	A	T	7: 85,411,859	N172K	probably benign	Het
Whrn	G	T	4: 63,418,592	P136T	possibly damaging	Het
Zfhx4	A	G	3: 5,413,110	N3570S	probably damaging	Het
Zfp689	A	G	7: 127,444,796	S221P	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R7944:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7986:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	not run
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	unknown

Predicted Primers

PCR Primer
(F):5'- AAAGTGCCATTCATGAGCAACAG -3'
(R):5'- TACAAGGCAAGGCTAAGATCAC -3'

Sequencing Primer
(F):5'- AGCCACCCTTAGTAATGTGTTAGGC -3'
(R):5'- GGCAAGGCTAAGATCACAGACAAAC -3'

Posted On

2018-05-04