Incidental Mutation 'R6380:Adat1'
ID515273
Institutional Source Beutler Lab
Gene Symbol Adat1
Ensembl Gene ENSMUSG00000031949
Gene Nameadenosine deaminase, tRNA-specific 1
SynonymsmADAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111966908-111992302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111978072 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 414 (T414K)
Ref Sequence ENSEMBL: ENSMUSP00000117279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034427] [ENSMUST00000120457] [ENSMUST00000139820]
Predicted Effect probably benign
Transcript: ENSMUST00000034427
AA Change: T414K

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034427
Gene: ENSMUSG00000031949
AA Change: T414K

DomainStartEndE-ValueType
ADEAMc 2 499 4.19e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120457
SMART Domains Protein: ENSMUSP00000113201
Gene: ENSMUSG00000031949

DomainStartEndE-ValueType
Pfam:A_deamin 63 354 8.1e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139820
AA Change: T414K

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117279
Gene: ENSMUSG00000031949
AA Change: T414K

DomainStartEndE-ValueType
ADEAMc 2 453 1e-141 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Adat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Adat1 APN 8 111982310 missense probably damaging 1.00
R0212:Adat1 UTSW 8 111987208 missense possibly damaging 0.50
R0559:Adat1 UTSW 8 111982430 missense probably damaging 1.00
R1521:Adat1 UTSW 8 111987235 missense possibly damaging 0.66
R1972:Adat1 UTSW 8 111990418 unclassified probably benign
R2217:Adat1 UTSW 8 111982496 missense probably benign 0.00
R3807:Adat1 UTSW 8 111990370 missense probably damaging 1.00
R4497:Adat1 UTSW 8 111979362 missense probably benign 0.06
R4553:Adat1 UTSW 8 111990280 missense probably damaging 1.00
R5702:Adat1 UTSW 8 111978072 missense probably benign 0.37
R5960:Adat1 UTSW 8 111982601 missense probably benign 0.00
R6538:Adat1 UTSW 8 111968462 missense probably benign
R6907:Adat1 UTSW 8 111972161 missense probably benign
R7022:Adat1 UTSW 8 111989862 missense probably damaging 1.00
R7440:Adat1 UTSW 8 111989898 missense probably damaging 0.99
R7606:Adat1 UTSW 8 111982604 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGTAGCAAAGGAGGGATTTCC -3'
(R):5'- CTCCAGTTAGTGCTGTCTGAAC -3'

Sequencing Primer
(F):5'- GAGGGATTTCCAAGGGCC -3'
(R):5'- GGCTACACTGAGTGGACATTAACTC -3'
Posted On2018-05-04