Incidental Mutation 'R6380:Dpy19l1'
ID515275
Institutional Source Beutler Lab
Gene Symbol Dpy19l1
Ensembl Gene ENSMUSG00000043067
Gene Namedpy-19-like 1 (C. elegans)
Synonyms1100001I19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location24411776-24503140 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 24482045 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 143 (K143*)
Ref Sequence ENSEMBL: ENSMUSP00000129575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115277] [ENSMUST00000142064] [ENSMUST00000170356]
Predicted Effect probably null
Transcript: ENSMUST00000115277
SMART Domains Protein: ENSMUSP00000110932
Gene: ENSMUSG00000043067

DomainStartEndE-ValueType
Pfam:Dpy19 10 549 1.6e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129048
Predicted Effect probably null
Transcript: ENSMUST00000142064
AA Change: K143*
SMART Domains Protein: ENSMUSP00000119986
Gene: ENSMUSG00000043067
AA Change: K143*

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 99 743 2e-247 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170356
AA Change: K143*
SMART Domains Protein: ENSMUSP00000129575
Gene: ENSMUSG00000043067
AA Change: K143*

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 98 743 5.5e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Dpy19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Dpy19l1 APN 9 24481930 missense probably damaging 0.99
IGL00788:Dpy19l1 APN 9 24462568 splice site probably benign
IGL00959:Dpy19l1 APN 9 24423197 splice site probably null
IGL01646:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01647:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01713:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01715:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01743:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01912:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL02417:Dpy19l1 APN 9 24475386 missense possibly damaging 0.48
IGL02629:Dpy19l1 APN 9 24438713 splice site probably benign
IGL02677:Dpy19l1 APN 9 24485072 missense probably damaging 1.00
IGL02949:Dpy19l1 APN 9 24421180 missense probably benign 0.44
IGL03067:Dpy19l1 APN 9 24438660 missense probably benign 0.00
R0066:Dpy19l1 UTSW 9 24414409 missense possibly damaging 0.95
R0207:Dpy19l1 UTSW 9 24453891 missense probably damaging 1.00
R0462:Dpy19l1 UTSW 9 24414349 missense probably benign 0.01
R0544:Dpy19l1 UTSW 9 24485110 splice site probably benign
R0749:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R0838:Dpy19l1 UTSW 9 24432431 missense probably damaging 0.98
R1114:Dpy19l1 UTSW 9 24424776 missense probably benign 0.30
R1546:Dpy19l1 UTSW 9 24475384 missense probably damaging 0.98
R1767:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R1926:Dpy19l1 UTSW 9 24473824 missense probably benign
R1933:Dpy19l1 UTSW 9 24434387 missense probably damaging 0.99
R2046:Dpy19l1 UTSW 9 24423159 missense probably damaging 0.98
R2101:Dpy19l1 UTSW 9 24482035 missense probably damaging 0.99
R4083:Dpy19l1 UTSW 9 24485048 missense possibly damaging 0.86
R4565:Dpy19l1 UTSW 9 24432388 missense probably null 1.00
R4649:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4652:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4653:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4669:Dpy19l1 UTSW 9 24432368 missense possibly damaging 0.94
R4746:Dpy19l1 UTSW 9 24450670 missense probably benign 0.29
R4769:Dpy19l1 UTSW 9 24426148 missense probably damaging 0.99
R4785:Dpy19l1 UTSW 9 24424823 missense probably damaging 1.00
R5177:Dpy19l1 UTSW 9 24438628 critical splice donor site probably null
R5466:Dpy19l1 UTSW 9 24414388 missense probably damaging 0.99
R5707:Dpy19l1 UTSW 9 24414267 makesense probably null
R6265:Dpy19l1 UTSW 9 24432371 missense possibly damaging 0.88
R6266:Dpy19l1 UTSW 9 24439146 missense probably damaging 0.99
R6290:Dpy19l1 UTSW 9 24462600 missense probably damaging 1.00
R6478:Dpy19l1 UTSW 9 24450696 missense possibly damaging 0.88
R6581:Dpy19l1 UTSW 9 24447864 missense possibly damaging 0.68
R6756:Dpy19l1 UTSW 9 24473784 missense probably damaging 0.99
R6773:Dpy19l1 UTSW 9 24440772 missense probably damaging 0.97
R6795:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R6796:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R7060:Dpy19l1 UTSW 9 24423123 missense possibly damaging 0.88
X0025:Dpy19l1 UTSW 9 24432380 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATCACAATTATAGATCCCAGAG -3'
(R):5'- TCTTCATACATGGCAAATGCAG -3'

Sequencing Primer
(F):5'- TATAGATCCCAGAGATTCAAAATCCC -3'
(R):5'- CATACATGGCAAATGCAGAATTG -3'
Posted On2018-05-04