Incidental Mutation 'R6380:Atat1'
ID515289
Institutional Source Beutler Lab
Gene Symbol Atat1
Ensembl Gene ENSMUSG00000024426
Gene Namealpha tubulin acetyltransferase 1
Synonyms2610110G12Rik, 0610011P08Rik, 3110080J08Rik, 2610008K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35897595-35910075 bp(-) (GRCm38)
Type of Mutationunclassified (1429 bp from exon)
DNA Base Change (assembly) C to A at 35908957 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025305] [ENSMUST00000056034] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000113782] [ENSMUST00000141132] [ENSMUST00000141662] [ENSMUST00000149277] [ENSMUST00000174807]
Predicted Effect probably null
Transcript: ENSMUST00000025305
SMART Domains Protein: ENSMUSP00000025305
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 109 161 8.1e-18 PFAM
low complexity region 196 207 N/A INTRINSIC
low complexity region 208 217 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000056034
AA Change: E111*
SMART Domains Protein: ENSMUSP00000053853
Gene: ENSMUSG00000024426
AA Change: E111*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061052
AA Change: E111*
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426
AA Change: E111*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077494
AA Change: E111*
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426
AA Change: E111*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113782
SMART Domains Protein: ENSMUSP00000109412
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 18 69 5.1e-16 PFAM
low complexity region 104 115 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126744
AA Change: E2*
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426
AA Change: E2*

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137069
Predicted Effect probably benign
Transcript: ENSMUST00000137182
Predicted Effect probably benign
Transcript: ENSMUST00000140292
SMART Domains Protein: ENSMUSP00000119039
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
PDB:4GS4|A 2 36 9e-13 PDB
low complexity region 50 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140990
Predicted Effect probably null
Transcript: ENSMUST00000141132
AA Change: E68*
SMART Domains Protein: ENSMUSP00000117824
Gene: ENSMUSG00000024426
AA Change: E68*

DomainStartEndE-ValueType
Pfam:Mec-17 29 149 9.1e-59 PFAM
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141662
AA Change: E111*
SMART Domains Protein: ENSMUSP00000115004
Gene: ENSMUSG00000024426
AA Change: E111*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.7e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149277
AA Change: E111*
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426
AA Change: E111*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151009
Predicted Effect probably null
Transcript: ENSMUST00000172642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173737
Predicted Effect probably null
Transcript: ENSMUST00000174349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174574
Predicted Effect probably null
Transcript: ENSMUST00000174807
SMART Domains Protein: ENSMUSP00000133584
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
SCOP:d1fjgr_ 91 128 1e-8 SMART
low complexity region 130 141 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired alpha tubulin acetylation and abnormal dentate gyrus morphology. Mice homozygous for a different knock-out allele exhibit reduced male fertility associated with teratozoospermia, oligozoospermia andasthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Atat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Atat1 APN 17 35897883 missense probably benign 0.04
IGL01903:Atat1 APN 17 35897800 missense probably benign 0.00
IGL01958:Atat1 APN 17 35908843 unclassified probably benign
IGL02725:Atat1 APN 17 35909489 missense probably benign 0.01
IGL02729:Atat1 APN 17 35898391 missense probably benign 0.00
R0633:Atat1 UTSW 17 35901423 missense probably damaging 1.00
R1541:Atat1 UTSW 17 35904331 missense probably damaging 1.00
R1944:Atat1 UTSW 17 35909340 missense probably damaging 1.00
R2054:Atat1 UTSW 17 35901369 missense probably null 0.99
R2132:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R4967:Atat1 UTSW 17 35901575 missense probably damaging 1.00
R6062:Atat1 UTSW 17 35908564 missense probably damaging 1.00
R6347:Atat1 UTSW 17 35910029 missense probably damaging 1.00
R7010:Atat1 UTSW 17 35908630 missense probably damaging 1.00
R7028:Atat1 UTSW 17 35910005 missense probably benign 0.01
R7230:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R7520:Atat1 UTSW 17 35897814 missense probably benign 0.36
R7607:Atat1 UTSW 17 35909107 missense possibly damaging 0.48
R8104:Atat1 UTSW 17 35904116 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGAGCATGCTAGCAGGATAC -3'
(R):5'- GGGAAAGGAGCCATTATTGGTTTC -3'

Sequencing Primer
(F):5'- AACTGTGGGCCATGGAGC -3'
(R):5'- GGAGCCATTATTGGTTTCCTCAAAG -3'
Posted On2018-05-04