Mutagenetix > Incidental Mutations

Incidental Mutation 'R6381:Irs1'

515293

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.544) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82287684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 937 (N937S)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069799
AA Change: N937S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: N937S

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Aars2	A	G	17: 45,518,545	E786G	probably benign	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dicer1	T	C	12: 104,696,462	D1620G	probably benign	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Nab2	T	C	10: 127,664,351	K291E	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Spata18	G	T	5: 73,675,216	K337N	probably damaging	Het
Supt16	A	G	14: 52,179,546	V325A	probably benign	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tep1	T	C	14: 50,845,431	D1040G	probably damaging	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TAGCTTTGACGAGGACAACC -3'
(R):5'- AAGGTAGACACAGCTGCAC -3'

Sequencing Primer
(F):5'- GGACAACCTATCTGCATGGTCATG -3'
(R):5'- AGCAGCAGCAGTCTTCCCTG -3'

Posted On

2018-05-04