Incidental Mutation 'R6381:Soat1'
ID 515298
Institutional Source Beutler Lab
Gene Symbol Soat1
Ensembl Gene ENSMUSG00000026600
Gene Name sterol O-acyltransferase 1
Synonyms ACAT-1, 8430426K15Rik, Acact, hid
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R6381 (G1)
Quality Score 213.009
Status Validated
Chromosome 1
Chromosomal Location 156424525-156474331 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 156435803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 392 (M392K)
Ref Sequence ENSEMBL: ENSMUSP00000140721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051396] [ENSMUST00000187507] [ENSMUST00000189661]
AlphaFold Q61263
Predicted Effect probably damaging
Transcript: ENSMUST00000051396
AA Change: M392K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058344
Gene: ENSMUSG00000026600
AA Change: M392K

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 3.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186420
Predicted Effect probably benign
Transcript: ENSMUST00000187507
SMART Domains Protein: ENSMUSP00000139431
Gene: ENSMUSG00000026600

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187987
Predicted Effect probably damaging
Transcript: ENSMUST00000189661
AA Change: M392K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140721
Gene: ENSMUSG00000026600
AA Change: M392K

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 1.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191379
Meta Mutation Damage Score 0.9253 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mutants producing no protein or a truncated protein show depletion of cholesterol esters in adrenal cortex and peritoneal macrophages. Additionally, null mutants have reduced eye openings due to atrophy of meibomian glands or abnromal morphology and arrangement of medullary cells of all hair types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Soat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Soat1 APN 1 156466730 missense probably benign 0.37
IGL00840:Soat1 APN 1 156434196 missense probably damaging 1.00
IGL00980:Soat1 APN 1 156441341 missense probably benign 0.00
IGL02032:Soat1 APN 1 156440575 missense probably benign 0.00
IGL02177:Soat1 APN 1 156440503 splice site probably benign
IGL02718:Soat1 APN 1 156441429 missense probably benign 0.02
IGL02756:Soat1 APN 1 156446575 missense probably benign
IGL02884:Soat1 APN 1 156441356 missense possibly damaging 0.88
R0309:Soat1 UTSW 1 156442453 missense probably damaging 1.00
R0315:Soat1 UTSW 1 156440513 nonsense probably null
R0492:Soat1 UTSW 1 156441354 missense probably benign 0.00
R0519:Soat1 UTSW 1 156441246 missense probably damaging 1.00
R1184:Soat1 UTSW 1 156442374 splice site probably null
R1187:Soat1 UTSW 1 156434175 missense probably damaging 1.00
R1310:Soat1 UTSW 1 156441332 missense possibly damaging 0.92
R1378:Soat1 UTSW 1 156466782 utr 5 prime probably benign
R1547:Soat1 UTSW 1 156439761 missense probably damaging 0.98
R1690:Soat1 UTSW 1 156444574 missense probably benign
R1771:Soat1 UTSW 1 156442421 missense probably benign
R1776:Soat1 UTSW 1 156442421 missense probably benign
R2264:Soat1 UTSW 1 156437697 splice site probably benign
R2483:Soat1 UTSW 1 156431099 missense probably damaging 1.00
R4838:Soat1 UTSW 1 156432937 missense probably benign 0.05
R4863:Soat1 UTSW 1 156432328 missense probably damaging 0.98
R5366:Soat1 UTSW 1 156444611 missense probably benign 0.00
R5828:Soat1 UTSW 1 156437748 missense probably benign 0.01
R6583:Soat1 UTSW 1 156466492 splice site probably null
R7085:Soat1 UTSW 1 156432331 missense probably damaging 0.97
R7228:Soat1 UTSW 1 156434238 missense probably damaging 1.00
R7464:Soat1 UTSW 1 156439317 missense probably damaging 1.00
R7593:Soat1 UTSW 1 156440578 nonsense probably null
R8098:Soat1 UTSW 1 156446610 missense probably damaging 1.00
R8837:Soat1 UTSW 1 156434202 missense probably damaging 1.00
R9300:Soat1 UTSW 1 156441353 missense probably benign 0.00
R9519:Soat1 UTSW 1 156432209 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTTACATGTGTGCCCACTC -3'
(R):5'- CGTGTTTATGACAGCTGGC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TGTTTATGACAGCTGGCTAAAGAAGC -3'
Posted On 2018-05-04