Incidental Mutation 'R6381:Bche'
ID515303
Institutional Source Beutler Lab
Gene Symbol Bche
Ensembl Gene ENSMUSG00000027792
Gene Namebutyrylcholinesterase
SynonymsC730038G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6381 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location73635808-73708415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73701799 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 98 (I98T)
Ref Sequence ENSEMBL: ENSMUSP00000029367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029367] [ENSMUST00000138216]
Predicted Effect probably benign
Transcript: ENSMUST00000029367
AA Change: I98T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029367
Gene: ENSMUSG00000027792
AA Change: I98T

DomainStartEndE-ValueType
Pfam:COesterase 10 551 5.2e-183 PFAM
Pfam:Abhydrolase_3 139 242 1.9e-7 PFAM
Pfam:AChE_tetra 566 602 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133690
Predicted Effect probably benign
Transcript: ENSMUST00000138216
AA Change: I98T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141329
Gene: ENSMUSG00000027792
AA Change: I98T

DomainStartEndE-ValueType
Pfam:COesterase 10 174 6.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153917
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Bche
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Bche APN 3 73701307 missense probably benign 0.00
IGL01420:Bche APN 3 73702009 missense probably benign 0.03
IGL02433:Bche APN 3 73701929 missense probably benign 0.02
IGL02734:Bche APN 3 73702076 missense probably benign 0.09
IGL03095:Bche APN 3 73701883 missense probably damaging 1.00
IGL03227:Bche APN 3 73701612 missense probably damaging 1.00
R0056:Bche UTSW 3 73701321 missense possibly damaging 0.79
R1780:Bche UTSW 3 73700620 missense probably benign 0.00
R1984:Bche UTSW 3 73701826 missense probably benign 0.03
R1984:Bche UTSW 3 73701827 missense probably benign
R2403:Bche UTSW 3 73701472 missense probably damaging 0.96
R4989:Bche UTSW 3 73701844 missense probably benign 0.02
R5231:Bche UTSW 3 73700861 missense probably benign 0.07
R5363:Bche UTSW 3 73700639 missense probably damaging 0.98
R5987:Bche UTSW 3 73648678 missense possibly damaging 0.59
R6164:Bche UTSW 3 73701056 missense possibly damaging 0.63
R6571:Bche UTSW 3 73701491 missense probably benign 0.08
R6801:Bche UTSW 3 73701800 missense probably benign
R6935:Bche UTSW 3 73701800 missense probably benign
R7275:Bche UTSW 3 73700636 missense probably benign 0.19
R7499:Bche UTSW 3 73701898 missense probably damaging 1.00
R7543:Bche UTSW 3 73701733 missense probably damaging 1.00
R7757:Bche UTSW 3 73701121 missense probably damaging 1.00
R7965:Bche UTSW 3 73701816 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAGAGAAGAGGTCCCAGTTTG -3'
(R):5'- CATGCCTTTTGGGAAGTCACAC -3'

Sequencing Primer
(F):5'- AGGTCCCAGTTTGAAAGCC -3'
(R):5'- CCTTTTGGGAAGTCACACACTGAAG -3'
Posted On2018-05-04