Incidental Mutation 'R6381:Spata18'
ID 515310
Institutional Source Beutler Lab
Gene Symbol Spata18
Ensembl Gene ENSMUSG00000029155
Gene Name spermatogenesis associated 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 73651379-73679512 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73675216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 337 (K337N)
Ref Sequence ENSEMBL: ENSMUSP00000137444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041422] [ENSMUST00000071077] [ENSMUST00000113548] [ENSMUST00000178631]
AlphaFold Q0P557
Predicted Effect probably damaging
Transcript: ENSMUST00000041422
AA Change: K419N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040922
Gene: ENSMUSG00000029155
AA Change: K419N

DomainStartEndE-ValueType
coiled coil region 178 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071077
AA Change: K451N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064308
Gene: ENSMUSG00000029155
AA Change: K451N

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113548
AA Change: K161N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109176
Gene: ENSMUSG00000029155
AA Change: K161N

DomainStartEndE-ValueType
Pfam:MIEAP 6 195 2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178631
AA Change: K337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137444
Gene: ENSMUSG00000029155
AA Change: K337N

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Pfam:MIEAP 296 485 1.2e-65 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a p53-inducible protein that is able to induce lysosome-like organelles within mitochondria that eliminate oxidized mitochondrial proteins, thereby contributing to mitochondrial quality control. Dysregulation of mitochondrial quality control is associated with cancer and degenerative diseases. The encoded protein mediates accumulation of the lysosome-like mitochondrial organelles through interaction with B cell lymphoma 2 interacting protein 3 and B cell lymphoma 2 interacting protein 3 like at the outer mitochondrial membrane, which allows translocation of lysosomal proteins to the mitochondrial matrix from the cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homo- or heterozygous KO in mice also carrying one copy of the ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Spata18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Spata18 APN 5 73657754 missense possibly damaging 0.80
IGL01331:Spata18 APN 5 73669681 missense probably damaging 1.00
IGL01394:Spata18 APN 5 73679345 splice site probably null
IGL01994:Spata18 APN 5 73657601 critical splice donor site probably null
IGL02192:Spata18 APN 5 73672518 splice site probably null
IGL02253:Spata18 APN 5 73668596 missense possibly damaging 0.61
IGL03195:Spata18 APN 5 73671248 missense probably damaging 1.00
IGL03204:Spata18 APN 5 73671106 splice site probably benign
ANU74:Spata18 UTSW 5 73671113 missense probably damaging 1.00
R0312:Spata18 UTSW 5 73666881 missense probably benign 0.00
R0557:Spata18 UTSW 5 73651670 missense probably damaging 1.00
R1624:Spata18 UTSW 5 73669545 missense probably damaging 0.98
R1901:Spata18 UTSW 5 73671139 missense probably damaging 1.00
R1937:Spata18 UTSW 5 73676964 missense probably damaging 1.00
R2228:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2229:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2896:Spata18 UTSW 5 73657802 missense probably damaging 1.00
R3082:Spata18 UTSW 5 73679080 intron probably benign
R3716:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R3717:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R4061:Spata18 UTSW 5 73671166 missense probably damaging 1.00
R4299:Spata18 UTSW 5 73666902 missense probably benign 0.36
R4963:Spata18 UTSW 5 73678993 missense probably damaging 0.96
R5603:Spata18 UTSW 5 73671232 missense probably benign 0.12
R6581:Spata18 UTSW 5 73669516 missense probably benign 0.14
R7062:Spata18 UTSW 5 73659293 missense probably benign 0.08
R7591:Spata18 UTSW 5 73672416 missense
R7682:Spata18 UTSW 5 73668665 missense
R7688:Spata18 UTSW 5 73651662 missense probably benign 0.14
R7783:Spata18 UTSW 5 73668610 missense
R8051:Spata18 UTSW 5 73669720 missense
R8765:Spata18 UTSW 5 73668649 missense
R8951:Spata18 UTSW 5 73671229 missense probably damaging 0.99
R9505:Spata18 UTSW 5 73651674 critical splice donor site probably null
R9514:Spata18 UTSW 5 73672497 missense
R9515:Spata18 UTSW 5 73672497 missense
X0061:Spata18 UTSW 5 73666859 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CATGCCATCTCTTGAACCAAGG -3'
(R):5'- CGAACTTGTGAAACAAACACTCGG -3'

Sequencing Primer
(F):5'- CTGATCACTGTCTAAATCTAGGCG -3'
(R):5'- TCGGGATGAACTGCCACTATAC -3'
Posted On 2018-05-04