Mutagenetix > Incidental Mutation

Incidental Mutation 'R6381:Spata18'

515310

Institutional Source

Beutler Lab

Gene Symbol

Spata18

Ensembl Gene

ENSMUSG00000029155

Gene Name

spermatogenesis associated 18

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73651379-73679512 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 73675216 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 337 (K337N)

Ref Sequence

ENSEMBL: ENSMUSP00000137444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041422] [ENSMUST00000071077] [ENSMUST00000113548] [ENSMUST00000178631]

AlphaFold

Q0P557

Predicted Effect

probably damaging
Transcript: ENSMUST00000041422
AA Change: K419N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040922
Gene: ENSMUSG00000029155
AA Change: K419N

Domain	Start	End	E-Value	Type
coiled coil region	178	211	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000071077
AA Change: K451N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064308
Gene: ENSMUSG00000029155
AA Change: K451N

Domain	Start	End	E-Value	Type
coiled coil region	151	184	N/A	INTRINSIC
coiled coil region	210	243	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113548
AA Change: K161N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109176
Gene: ENSMUSG00000029155
AA Change: K161N

Domain	Start	End	E-Value	Type
Pfam:MIEAP	6	195	2e-67	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000178631
AA Change: K337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137444
Gene: ENSMUSG00000029155
AA Change: K337N

Domain	Start	End	E-Value	Type
coiled coil region	151	184	N/A	INTRINSIC
coiled coil region	210	243	N/A	INTRINSIC
Pfam:MIEAP	296	485	1.2e-65	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a p53-inducible protein that is able to induce lysosome-like organelles within mitochondria that eliminate oxidized mitochondrial proteins, thereby contributing to mitochondrial quality control. Dysregulation of mitochondrial quality control is associated with cancer and degenerative diseases. The encoded protein mediates accumulation of the lysosome-like mitochondrial organelles through interaction with B cell lymphoma 2 interacting protein 3 and B cell lymphoma 2 interacting protein 3 like at the outer mitochondrial membrane, which allows translocation of lysosomal proteins to the mitochondrial matrix from the cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homo- or heterozygous KO in mice also carrying one copy of the Apc^Min allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Aars2	A	G	17: 45,518,545	E786G	probably benign	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dicer1	T	C	12: 104,696,462	D1620G	probably benign	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Irs1	T	C	1: 82,287,684	N937S	possibly damaging	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Nab2	T	C	10: 127,664,351	K291E	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Supt16	A	G	14: 52,179,546	V325A	probably benign	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tep1	T	C	14: 50,845,431	D1040G	probably damaging	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Spata18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Spata18	APN	5	73657754	missense	possibly damaging	0.80
IGL01331:Spata18	APN	5	73669681	missense	probably damaging	1.00
IGL01394:Spata18	APN	5	73679345	splice site	probably null
IGL01994:Spata18	APN	5	73657601	critical splice donor site	probably null
IGL02192:Spata18	APN	5	73672518	splice site	probably null
IGL02253:Spata18	APN	5	73668596	missense	possibly damaging	0.61
IGL03195:Spata18	APN	5	73671248	missense	probably damaging	1.00
IGL03204:Spata18	APN	5	73671106	splice site	probably benign
ANU74:Spata18	UTSW	5	73671113	missense	probably damaging	1.00
R0312:Spata18	UTSW	5	73666881	missense	probably benign	0.00
R0557:Spata18	UTSW	5	73651670	missense	probably damaging	1.00
R1624:Spata18	UTSW	5	73669545	missense	probably damaging	0.98
R1901:Spata18	UTSW	5	73671139	missense	probably damaging	1.00
R1937:Spata18	UTSW	5	73676964	missense	probably damaging	1.00
R2228:Spata18	UTSW	5	73666901	missense	possibly damaging	0.57
R2229:Spata18	UTSW	5	73666901	missense	possibly damaging	0.57
R2896:Spata18	UTSW	5	73657802	missense	probably damaging	1.00
R3082:Spata18	UTSW	5	73679080	intron	probably benign
R3716:Spata18	UTSW	5	73666850	critical splice acceptor site	probably null
R3717:Spata18	UTSW	5	73666850	critical splice acceptor site	probably null
R4061:Spata18	UTSW	5	73671166	missense	probably damaging	1.00
R4299:Spata18	UTSW	5	73666902	missense	probably benign	0.36
R4963:Spata18	UTSW	5	73678993	missense	probably damaging	0.96
R5603:Spata18	UTSW	5	73671232	missense	probably benign	0.12
R6581:Spata18	UTSW	5	73669516	missense	probably benign	0.14
R7062:Spata18	UTSW	5	73659293	missense	probably benign	0.08
R7591:Spata18	UTSW	5	73672416	missense
R7682:Spata18	UTSW	5	73668665	missense
R7688:Spata18	UTSW	5	73651662	missense	probably benign	0.14
R7783:Spata18	UTSW	5	73668610	missense
R8051:Spata18	UTSW	5	73669720	missense
R8765:Spata18	UTSW	5	73668649	missense
R8951:Spata18	UTSW	5	73671229	missense	probably damaging	0.99
R9505:Spata18	UTSW	5	73651674	critical splice donor site	probably null
R9514:Spata18	UTSW	5	73672497	missense
R9515:Spata18	UTSW	5	73672497	missense
X0061:Spata18	UTSW	5	73666859	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CATGCCATCTCTTGAACCAAGG -3'
(R):5'- CGAACTTGTGAAACAAACACTCGG -3'

Sequencing Primer
(F):5'- CTGATCACTGTCTAAATCTAGGCG -3'
(R):5'- TCGGGATGAACTGCCACTATAC -3'

Posted On

2018-05-04