Incidental Mutation 'R6381:Ryr1'
ID 515315
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms calcium release channel isoform 1, Ryr, skrr
MMRRC Submission 044530-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28702765-28824599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 28774682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2313 (M2313L)
Ref Sequence ENSEMBL: ENSMUSP00000032813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032813
AA Change: M2313L

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: M2313L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: M2313L

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: M2313L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209109
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: M2320L

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,788 (GRCm39) M365L probably damaging Het
Aars2 A G 17: 45,829,471 (GRCm39) E786G probably benign Het
Adamts12 G T 15: 11,257,080 (GRCm39) V478F possibly damaging Het
Akr1c21 T A 13: 4,624,183 (GRCm39) D12E probably damaging Het
Aplf A T 6: 87,635,959 (GRCm39) M118K probably damaging Het
Apobec1 A G 6: 122,555,890 (GRCm39) L189P probably damaging Het
BC061237 A G 14: 44,741,713 (GRCm39) Q152R possibly damaging Het
Bche A G 3: 73,609,132 (GRCm39) I98T probably benign Het
Cc2d2a G T 5: 43,873,118 (GRCm39) R983L possibly damaging Het
Ccnd3 T C 17: 47,816,149 (GRCm39) probably benign Het
Cd74 G T 18: 60,944,435 (GRCm39) C215F probably damaging Het
Cep97 C T 16: 55,742,534 (GRCm39) A138T probably damaging Het
Ces1e T A 8: 93,944,206 (GRCm39) N204I probably damaging Het
Dicer1 T C 12: 104,662,721 (GRCm39) D1620G probably benign Het
Dnah17 A G 11: 118,020,011 (GRCm39) V12A probably benign Het
Dstyk T A 1: 132,384,503 (GRCm39) probably null Het
Elapor1 T C 3: 108,389,130 (GRCm39) K222E possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Entr1 A G 2: 26,275,093 (GRCm39) probably null Het
Gm10570 G T 4: 130,202,021 (GRCm39) probably benign Het
Gm7145 C T 1: 117,913,669 (GRCm39) Q184* probably null Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Gtse1 G A 15: 85,746,349 (GRCm39) R55H probably benign Het
Hdac4 G T 1: 91,912,247 (GRCm39) Q381K possibly damaging Het
Ifit3b T C 19: 34,589,871 (GRCm39) I349T probably benign Het
Inpp5a A T 7: 138,980,589 (GRCm39) D9V probably benign Het
Irs1 T C 1: 82,265,405 (GRCm39) N937S possibly damaging Het
Kcna4 T C 2: 107,125,317 (GRCm39) M17T probably benign Het
Lipa T A 19: 34,502,146 (GRCm39) M33L probably benign Het
Marchf6 G T 15: 31,467,838 (GRCm39) Q790K probably benign Het
Mccc1 G A 3: 36,030,876 (GRCm39) P397S probably benign Het
Mrgprb2 T C 7: 48,202,138 (GRCm39) I196V probably benign Het
Myh15 T A 16: 48,921,844 (GRCm39) S463R probably damaging Het
Nab2 T C 10: 127,500,220 (GRCm39) K291E probably damaging Het
Neto2 T C 8: 86,369,138 (GRCm39) T294A probably damaging Het
Nkx1-1 T C 5: 33,591,320 (GRCm39) M1V probably null Het
Or2h2 C T 17: 37,396,977 (GRCm39) V27I probably benign Het
Pla2g4c C T 7: 13,077,933 (GRCm39) T357I probably benign Het
Psmd2 A G 16: 20,474,023 (GRCm39) E242G probably benign Het
Rnase12 A C 14: 51,294,551 (GRCm39) Y43D probably damaging Het
Rpl18 T A 7: 45,369,016 (GRCm39) F58I probably damaging Het
Scn4a G T 11: 106,211,137 (GRCm39) Q1627K probably damaging Het
Scnn1g A G 7: 121,366,722 (GRCm39) S640G probably benign Het
Sdr9c7 T A 10: 127,739,542 (GRCm39) M219K probably benign Het
Soat1 A T 1: 156,263,373 (GRCm39) M392K probably damaging Het
Spata18 G T 5: 73,832,559 (GRCm39) K337N probably damaging Het
Supt16 A G 14: 52,417,003 (GRCm39) V325A probably benign Het
Syt2 A G 1: 134,674,588 (GRCm39) E342G probably damaging Het
Tars2 A T 3: 95,661,799 (GRCm39) L37* probably null Het
Tep1 T C 14: 51,082,888 (GRCm39) D1040G probably damaging Het
Tmc8 A T 11: 117,682,426 (GRCm39) S613C probably null Het
Top3a C T 11: 60,634,849 (GRCm39) C660Y probably damaging Het
Tpsg1 C T 17: 25,591,543 (GRCm39) R48C probably damaging Het
Vmn2r57 T C 7: 41,078,242 (GRCm39) N72S probably benign Het
Whrn G A 4: 63,390,921 (GRCm39) T269I probably benign Het
Zfp759 T A 13: 67,286,969 (GRCm39) Y173* probably null Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 28,802,235 (GRCm39) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 28,824,385 (GRCm39) splice site probably null
IGL00427:Ryr1 APN 7 28,804,162 (GRCm39) splice site probably benign
IGL00559:Ryr1 APN 7 28,711,667 (GRCm39) splice site probably benign
IGL00803:Ryr1 APN 7 28,769,070 (GRCm39) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 28,723,654 (GRCm39) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 28,719,620 (GRCm39) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 28,781,968 (GRCm39) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 28,799,627 (GRCm39) splice site probably benign
IGL01385:Ryr1 APN 7 28,756,410 (GRCm39) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 28,751,762 (GRCm39) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 28,774,652 (GRCm39) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 28,790,501 (GRCm39) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 28,778,022 (GRCm39) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 28,759,235 (GRCm39) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 28,771,083 (GRCm39) missense probably benign 0.16
IGL02152:Ryr1 APN 7 28,751,440 (GRCm39) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 28,793,472 (GRCm39) missense probably benign 0.07
IGL02321:Ryr1 APN 7 28,778,121 (GRCm39) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 28,804,491 (GRCm39) splice site probably benign
IGL02472:Ryr1 APN 7 28,740,269 (GRCm39) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 28,815,024 (GRCm39) missense probably benign 0.24
IGL02666:Ryr1 APN 7 28,719,188 (GRCm39) missense unknown
IGL02672:Ryr1 APN 7 28,703,944 (GRCm39) unclassified probably benign
IGL02677:Ryr1 APN 7 28,810,033 (GRCm39) missense probably benign 0.18
IGL02686:Ryr1 APN 7 28,768,975 (GRCm39) splice site probably benign
IGL02751:Ryr1 APN 7 28,778,199 (GRCm39) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 28,748,220 (GRCm39) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 28,760,965 (GRCm39) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 28,796,884 (GRCm39) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 28,759,478 (GRCm39) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 28,743,318 (GRCm39) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 28,770,084 (GRCm39) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 28,782,911 (GRCm39) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 28,804,018 (GRCm39) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 28,774,624 (GRCm39) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 28,802,389 (GRCm39) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 28,715,211 (GRCm39) missense unknown
IGL03146:Ryr1 APN 7 28,793,457 (GRCm39) missense probably benign 0.09
IGL03165:Ryr1 APN 7 28,804,465 (GRCm39) missense probably benign 0.22
IGL03220:Ryr1 APN 7 28,759,280 (GRCm39) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 28,746,967 (GRCm39) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0069:Ryr1 UTSW 7 28,809,930 (GRCm39) splice site probably benign
R0148:Ryr1 UTSW 7 28,751,460 (GRCm39) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 28,767,013 (GRCm39) splice site probably benign
R0387:Ryr1 UTSW 7 28,782,792 (GRCm39) splice site probably benign
R0454:Ryr1 UTSW 7 28,735,500 (GRCm39) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 28,703,218 (GRCm39) splice site probably benign
R0533:Ryr1 UTSW 7 28,778,205 (GRCm39) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 28,735,501 (GRCm39) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 28,804,220 (GRCm39) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 28,774,034 (GRCm39) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 28,799,614 (GRCm39) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 28,709,122 (GRCm39) missense unknown
R1052:Ryr1 UTSW 7 28,795,683 (GRCm39) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 28,785,534 (GRCm39) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 28,815,437 (GRCm39) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 28,770,046 (GRCm39) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 28,782,962 (GRCm39) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 28,791,600 (GRCm39) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 28,761,616 (GRCm39) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 28,794,915 (GRCm39) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 28,793,686 (GRCm39) missense probably benign 0.03
R1661:Ryr1 UTSW 7 28,801,163 (GRCm39) missense probably damaging 0.98
R1665:Ryr1 UTSW 7 28,735,503 (GRCm39) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 28,815,579 (GRCm39) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 28,777,989 (GRCm39) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 28,746,928 (GRCm39) missense probably benign 0.25
R1720:Ryr1 UTSW 7 28,801,295 (GRCm39) missense probably damaging 0.99
R1799:Ryr1 UTSW 7 28,767,046 (GRCm39) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 28,779,236 (GRCm39) missense probably benign 0.43
R1860:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1861:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1921:Ryr1 UTSW 7 28,754,369 (GRCm39) missense probably damaging 1.00
R1983:Ryr1 UTSW 7 28,758,897 (GRCm39) missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 28,759,056 (GRCm39) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 28,789,575 (GRCm39) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 28,767,867 (GRCm39) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 28,719,166 (GRCm39) missense unknown
R2291:Ryr1 UTSW 7 28,798,202 (GRCm39) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 28,774,718 (GRCm39) missense probably benign 0.18
R2512:Ryr1 UTSW 7 28,802,967 (GRCm39) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 28,735,551 (GRCm39) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 28,708,987 (GRCm39) missense unknown
R2885:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 28,778,166 (GRCm39) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 28,745,071 (GRCm39) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 28,774,373 (GRCm39) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 28,769,075 (GRCm39) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 28,719,577 (GRCm39) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 28,772,327 (GRCm39) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 28,794,549 (GRCm39) missense probably benign 0.41
R4041:Ryr1 UTSW 7 28,785,356 (GRCm39) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 28,761,576 (GRCm39) nonsense probably null
R4257:Ryr1 UTSW 7 28,781,875 (GRCm39) missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 28,782,484 (GRCm39) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 28,793,667 (GRCm39) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 28,789,581 (GRCm39) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 28,798,160 (GRCm39) missense probably benign 0.05
R4554:Ryr1 UTSW 7 28,804,433 (GRCm39) missense probably benign 0.03
R4562:Ryr1 UTSW 7 28,774,005 (GRCm39) intron probably benign
R4642:Ryr1 UTSW 7 28,785,463 (GRCm39) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 28,759,256 (GRCm39) missense probably null 0.99
R4707:Ryr1 UTSW 7 28,745,087 (GRCm39) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 28,785,258 (GRCm39) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 28,704,246 (GRCm39) unclassified probably benign
R4770:Ryr1 UTSW 7 28,808,707 (GRCm39) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 28,794,522 (GRCm39) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 28,719,408 (GRCm39) missense unknown
R4933:Ryr1 UTSW 7 28,803,723 (GRCm39) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 28,767,520 (GRCm39) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 28,768,998 (GRCm39) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 28,778,208 (GRCm39) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 28,768,540 (GRCm39) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5013:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5137:Ryr1 UTSW 7 28,801,283 (GRCm39) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 28,767,118 (GRCm39) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 28,735,553 (GRCm39) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 28,815,023 (GRCm39) missense probably benign 0.03
R5303:Ryr1 UTSW 7 28,767,907 (GRCm39) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 28,816,841 (GRCm39) missense probably damaging 0.98
R5431:Ryr1 UTSW 7 28,809,237 (GRCm39) missense probably benign 0.39
R5460:Ryr1 UTSW 7 28,771,386 (GRCm39) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 28,723,448 (GRCm39) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 28,768,453 (GRCm39) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 28,785,610 (GRCm39) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 28,715,148 (GRCm39) missense unknown
R5575:Ryr1 UTSW 7 28,778,118 (GRCm39) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 28,811,399 (GRCm39) missense probably benign 0.05
R5658:Ryr1 UTSW 7 28,790,514 (GRCm39) splice site probably null
R5918:Ryr1 UTSW 7 28,708,577 (GRCm39) missense probably benign 0.39
R5926:Ryr1 UTSW 7 28,803,785 (GRCm39) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 28,746,290 (GRCm39) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 28,815,552 (GRCm39) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 28,771,349 (GRCm39) missense probably null 0.98
R5991:Ryr1 UTSW 7 28,804,035 (GRCm39) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 28,767,062 (GRCm39) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 28,723,666 (GRCm39) missense probably benign 0.38
R6075:Ryr1 UTSW 7 28,786,863 (GRCm39) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 28,771,398 (GRCm39) missense probably benign 0.01
R6126:Ryr1 UTSW 7 28,775,664 (GRCm39) missense probably null 1.00
R6147:Ryr1 UTSW 7 28,785,339 (GRCm39) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 28,815,606 (GRCm39) missense probably benign 0.07
R6279:Ryr1 UTSW 7 28,786,853 (GRCm39) missense possibly damaging 0.93
R6441:Ryr1 UTSW 7 28,759,120 (GRCm39) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 28,776,503 (GRCm39) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 28,715,079 (GRCm39) missense probably benign 0.39
R6514:Ryr1 UTSW 7 28,746,266 (GRCm39) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 28,794,917 (GRCm39) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 28,737,770 (GRCm39) critical splice donor site probably null
R6746:Ryr1 UTSW 7 28,816,829 (GRCm39) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 28,764,299 (GRCm39) missense probably benign 0.12
R6800:Ryr1 UTSW 7 28,723,741 (GRCm39) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 28,751,751 (GRCm39) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 28,808,812 (GRCm39) missense probably benign 0.03
R6995:Ryr1 UTSW 7 28,793,607 (GRCm39) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 28,803,068 (GRCm39) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 28,746,279 (GRCm39) missense probably benign 0.37
R7238:Ryr1 UTSW 7 28,794,807 (GRCm39) missense probably benign 0.24
R7240:Ryr1 UTSW 7 28,751,440 (GRCm39) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 28,758,936 (GRCm39) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 28,785,180 (GRCm39) missense probably benign 0.05
R7403:Ryr1 UTSW 7 28,713,292 (GRCm39) missense probably benign 0.34
R7422:Ryr1 UTSW 7 28,785,295 (GRCm39) missense probably benign 0.00
R7493:Ryr1 UTSW 7 28,794,630 (GRCm39) missense probably benign 0.44
R7570:Ryr1 UTSW 7 28,778,010 (GRCm39) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 28,735,528 (GRCm39) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 28,798,210 (GRCm39) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 28,767,055 (GRCm39) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 28,804,257 (GRCm39) missense probably benign 0.39
R7799:Ryr1 UTSW 7 28,702,985 (GRCm39) splice site probably null
R7916:Ryr1 UTSW 7 28,790,364 (GRCm39) nonsense probably null
R7922:Ryr1 UTSW 7 28,796,649 (GRCm39) missense probably benign 0.09
R7988:Ryr1 UTSW 7 28,795,596 (GRCm39) missense probably benign 0.29
R7997:Ryr1 UTSW 7 28,702,968 (GRCm39) missense unknown
R8052:Ryr1 UTSW 7 28,782,810 (GRCm39) missense probably benign 0.05
R8096:Ryr1 UTSW 7 28,708,626 (GRCm39) missense unknown
R8116:Ryr1 UTSW 7 28,810,308 (GRCm39) missense probably benign 0.03
R8202:Ryr1 UTSW 7 28,790,457 (GRCm39) missense probably benign 0.18
R8207:Ryr1 UTSW 7 28,789,650 (GRCm39) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 28,768,546 (GRCm39) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 28,764,064 (GRCm39) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8454:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8487:Ryr1 UTSW 7 28,740,292 (GRCm39) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 28,769,509 (GRCm39) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 28,704,239 (GRCm39) unclassified probably benign
R8678:Ryr1 UTSW 7 28,776,489 (GRCm39) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 28,751,753 (GRCm39) missense probably benign 0.03
R8724:Ryr1 UTSW 7 28,816,802 (GRCm39) missense probably benign 0.04
R8755:Ryr1 UTSW 7 28,791,693 (GRCm39) missense probably benign 0.19
R8772:Ryr1 UTSW 7 28,815,557 (GRCm39) missense probably benign 0.05
R8790:Ryr1 UTSW 7 28,776,297 (GRCm39) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 28,764,284 (GRCm39) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 28,774,091 (GRCm39) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 28,808,638 (GRCm39) missense probably benign 0.00
R8910:Ryr1 UTSW 7 28,771,340 (GRCm39) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 28,789,640 (GRCm39) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 28,801,358 (GRCm39) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 28,790,422 (GRCm39) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 28,803,989 (GRCm39) nonsense probably null
R9123:Ryr1 UTSW 7 28,771,229 (GRCm39) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 28,769,283 (GRCm39) missense probably benign 0.08
R9189:Ryr1 UTSW 7 28,776,471 (GRCm39) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 28,794,524 (GRCm39) missense probably benign 0.00
R9214:Ryr1 UTSW 7 28,785,187 (GRCm39) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 28,801,277 (GRCm39) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 28,743,313 (GRCm39) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 28,751,813 (GRCm39) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 28,802,254 (GRCm39) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 28,802,389 (GRCm39) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 28,717,387 (GRCm39) missense unknown
R9333:Ryr1 UTSW 7 28,774,214 (GRCm39) critical splice donor site probably null
R9459:Ryr1 UTSW 7 28,768,068 (GRCm39) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 28,772,510 (GRCm39) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 28,777,965 (GRCm39) missense probably benign 0.15
R9524:Ryr1 UTSW 7 28,723,600 (GRCm39) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 28,715,138 (GRCm39) missense unknown
R9664:Ryr1 UTSW 7 28,759,092 (GRCm39) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 28,774,664 (GRCm39) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 28,760,956 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,802,923 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,785,460 (GRCm39) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 28,719,639 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,801,347 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,748,217 (GRCm39) nonsense probably null
Z1177:Ryr1 UTSW 7 28,717,410 (GRCm39) missense unknown
Z1186:Ryr1 UTSW 7 28,781,902 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTCAAGGGTAATGTCAGGTCCC -3'
(R):5'- CTTTATCACAAGTGAGACAGGACC -3'

Sequencing Primer
(F):5'- CTGCAAGTCTACTTAGAGGGACC -3'
(R):5'- CCAGTGTTGGGCAGGAG -3'
Posted On 2018-05-04