Incidental Mutation 'R6381:Neto2'
ID515321
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6381 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85636588-85700924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85642509 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 294 (T294A)
Ref Sequence ENSEMBL: ENSMUSP00000148172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: T329A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: T329A

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: T294A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably benign
Transcript: ENSMUST00000216286
AA Change: T301A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1395 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3822:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3940:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4433:Neto2 UTSW 8 85641083 missense probably damaging 1.00
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R5571:Neto2 UTSW 8 85640544 missense probably damaging 1.00
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6572:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6881:Neto2 UTSW 8 85640556 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
R7754:Neto2 UTSW 8 85669700 missense probably damaging 0.98
R7755:Neto2 UTSW 8 85669656 missense probably damaging 1.00
R8682:Neto2 UTSW 8 85640666 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTAGAGCACTATGGTAGGC -3'
(R):5'- CATTGCAGAAACACACTGAAGG -3'

Sequencing Primer
(F):5'- TAGAGCACTATGGTAGGCACACC -3'
(R):5'- GAACCTGTAATGTCAACTCTTGGGAG -3'
Posted On2018-05-04