Incidental Mutation 'R6381:Tmc8'
ID 515327
Institutional Source Beutler Lab
Gene Symbol Tmc8
Ensembl Gene ENSMUSG00000050106
Gene Name transmembrane channel-like gene family 8
Synonyms Ever2, EVIN2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 117782076-117793110 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117791600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 613 (S613C)
Ref Sequence ENSEMBL: ENSMUSP00000113628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050874] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455]
AlphaFold Q7TN58
Predicted Effect probably null
Transcript: ENSMUST00000050874
AA Change: S612C

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106
AA Change: S612C

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106334
AA Change: S613C

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106
AA Change: S613C

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117781
AA Change: S612C

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106
AA Change: S612C

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119455
AA Change: S613C

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106
AA Change: S613C

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156458
Meta Mutation Damage Score 0.2621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Tmc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Tmc8 APN 11 117786504 missense probably damaging 1.00
IGL01098:Tmc8 APN 11 117792563 missense possibly damaging 0.47
IGL01403:Tmc8 APN 11 117791074 missense possibly damaging 0.94
IGL01526:Tmc8 APN 11 117792084 splice site probably benign
IGL02045:Tmc8 APN 11 117786520 missense probably damaging 1.00
IGL02138:Tmc8 APN 11 117791255 missense probably benign 0.01
IGL02581:Tmc8 APN 11 117783888 missense probably benign 0.01
IGL02685:Tmc8 APN 11 117792574 missense probably damaging 0.96
R0241:Tmc8 UTSW 11 117786381 unclassified probably benign
R0485:Tmc8 UTSW 11 117792078 splice site probably benign
R1168:Tmc8 UTSW 11 117792563 missense possibly damaging 0.47
R1701:Tmc8 UTSW 11 117791362 splice site probably null
R2425:Tmc8 UTSW 11 117792569 missense probably damaging 0.96
R2509:Tmc8 UTSW 11 117792685 missense possibly damaging 0.66
R4747:Tmc8 UTSW 11 117792724 missense probably benign 0.27
R4783:Tmc8 UTSW 11 117791605 splice site probably null
R5821:Tmc8 UTSW 11 117792629 nonsense probably null
R5923:Tmc8 UTSW 11 117783812 missense probably damaging 1.00
R6712:Tmc8 UTSW 11 117784813 missense probably benign 0.43
R7351:Tmc8 UTSW 11 117783828 missense probably damaging 1.00
R7493:Tmc8 UTSW 11 117784932 missense probably benign 0.00
R7818:Tmc8 UTSW 11 117792127 missense probably damaging 1.00
R8190:Tmc8 UTSW 11 117791360 critical splice donor site probably null
R8699:Tmc8 UTSW 11 117783535 missense possibly damaging 0.71
R8780:Tmc8 UTSW 11 117790732 frame shift probably null
RF021:Tmc8 UTSW 11 117783234 missense probably benign 0.00
Z1176:Tmc8 UTSW 11 117786409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTACGTGATCAGCAGGTGAC -3'
(R):5'- AAGGCAAGTTGGTTCACCCG -3'

Sequencing Primer
(F):5'- CCCAGATTCTGACAAGCCTG -3'
(R):5'- TCACCCGGGGCTGTGTTG -3'
Posted On 2018-05-04