Mutagenetix > Incidental Mutation

Incidental Mutation 'R6381:Dicer1'

515329

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104696462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1620 (D1620G)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041987
AA Change: D1620G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: D1620G

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.0589

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Aars2	A	G	17: 45,518,545	E786G	probably benign	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Irs1	T	C	1: 82,287,684	N937S	possibly damaging	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Nab2	T	C	10: 127,664,351	K291E	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Spata18	G	T	5: 73,675,216	K337N	probably damaging	Het
Supt16	A	G	14: 52,179,546	V325A	probably benign	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tep1	T	C	14: 50,845,431	D1040G	probably damaging	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104722147	nonsense	probably null
R9682:Dicer1	UTSW	12	104706225	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- GGAGCTCCTTACCAGTGATAGTG -3'
(R):5'- GGCTGCTACTTAACCAGCTG -3'

Sequencing Primer
(F):5'- CTCCTTACCAGTGATAGTGTTGTAG -3'
(R):5'- TACTTAACCAGCTGCGGCGAG -3'

Posted On

2018-05-04