Mutagenetix > Incidental Mutations

Incidental Mutation 'R6381:Tep1'

515333

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50845431 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1040 (D1040G)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006444
AA Change: D1040G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: D1040G

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000226430
AA Change: D315G

Meta Mutation Damage Score

0.3999

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Aars2	A	G	17: 45,518,545	E786G	probably benign	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dicer1	T	C	12: 104,696,462	D1620G	probably benign	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Irs1	T	C	1: 82,287,684	N937S	possibly damaging	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Nab2	T	C	10: 127,664,351	K291E	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Spata18	G	T	5: 73,675,216	K337N	probably damaging	Het
Supt16	A	G	14: 52,179,546	V325A	probably benign	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGGTTTCCAGGCATCTG -3'
(R):5'- TTCCAGAGATGGGCTGATGC -3'

Sequencing Primer
(F):5'- CTGTCATCAGCCAGGAGATAAG -3'
(R):5'- CTGATGCTTGGGACTGACC -3'

Posted On

2018-05-04